Clone Read LE_HBa0145M16_T7_71647

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0145M16_T7_71647
Primer
T7
ID from Seq. Facility
LE_HBa_145_M16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
573 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0145M16_T7_71647 (raw untrimmed)
TTGGTCTGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGAAACTGTTTTAAGGTCTTTTTGAATGAATATATGTCATCTAGGAA
GTCTAGAAATCAAAACGTCAAAGAACATCTATCACGTGTAGAAACTAGTTCAATGAGGTACTAGCATGCCTTAGCCTATTTGACTAGGTTTTATGTGTCG
GAAAATGATGAAAATTGATTGAAGGGTGTCTAACACGTATTAGAGTTGATCCGTAGTCAAAACTTTTGGGCACAAATCCCCAAGGACCAACCAAAGGCCC
TTGAGGAGGACCCTATCATTTTGAAGTCCAAGGCTACCCAAGGCAGTGTCCACCAACGGATGCAACACACAATAAATTGTCCAATCGACGCGGTGTGGAC
TGCTTCCGTCGCTGGAAACTTAGTCAAATTTTTGGAAGACTACAAATGACAGTCTTTGAACTCATCGATGAGTTAGCATCATGAAAGTGAACTGTACTCA
TCGATGGACACATTATCTATCGATCGTTGTCTCGTCTGTGGATCCACTGTTTTACTGCACATTTTTAATAAATTTGTAATTCATTTTCTTAGTTAGGAGG
TTAATTAGGGGTTAGGGGAGGTCTATTCATTTAAATTGACACCTTATTTCGGGACTTCCCGCCTTCCCACTTACCTAATTTCTTGAAACTATAACGCAAT
TCTGTGCTATCTATATTTCCTCCTAGTTGAGACCCTTTGCAAGGTAAGTTAGGGGGGATCTATAGGGATCTCTCTTAAACTTCGTCACGCTTGAATATGA
TAGGCGATTATCTATCCTCTTTTAGTGGCTCTTTTCGGGGTCATCCAGGCGT
>LE_HBa0145M16_T7_71647 (trimmed for quality and cloning vector)
AGCTTTAGAAACTGTTTTAAGGTCTTTTTGAATGAATATATGTCATCTAGGAAGTCTAGAAATCAAAACGTCAAAGAACATCTATCACGTGTAGAAACTA
GTTCAATGAGGTACTAGCATGCCTTAGCCTATTTGACTAGGTTTTATGTGTCGGAAAATGATGAAAATTGATTGAAGGGTGTCTAACACGTATTAGAGTT
GATCCGTAGTCAAAACTTTTGGGCACAAATCCCCAAGGACCAACCAAAGGCCCTTGAGGAGGACCCTATCATTTTGAAGTCCAAGGCTACCCAAGGCAGT
GTCCACCAACGGATGCAACACACAATAAATTGTCCAATCGACGCGGTGTGGACTGCTTCCGTCGCTGGAAACTTAGTCAAATTTTTGGAAGACTACAAAT
GACAGTCTTTGAACTCATCGATGAGTTAGCATCATGAAAGTGAACTGTACTCATCGATGGACACATTATCTATCGATCGTTGTCTCGTCTGTGGATCCAC
TGTTTTACTGCACATTTTTAATAAATTTGTAATTCATTTTCTTAGTTAGGAGGTTAATTAGGGGTTAGGGGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974422
Expected error %
0.00397062
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0145M16
Clone
Clone name
hba-145m16
LE_HBa0145M16
P145M16
Clone type
BAC
Contamination
none
Estimated length
90,500
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found