Clone Read RH008J10_T7_719685

Sequence Read 
Read Class
BAC ends
Read ID
RH008J10_T7_719685
Primer
T7
ID from Seq. Facility
not recorded
Chromatogram
not availabe for
direct download
Sequence 
Version
1 (current)
Length (bp)
669 trimmed for vector and quality, 669 raw
Sequence
>RH008J10_T7_719685 (raw untrimmed)
GCATTCCTCTTGGACACCCATTTGCCGCATGAAGACCAGCCTACGCCTTACGCCACTCACTCTCTTGAGCTGAGTGTTAGGATTTGGGACTAGGGCTCAC
CCTCTCGGGCTGGACCTTATGTCGACCCACTCCTTAGGCCATCAGTCTAGTAGTCTTGGTTTCGCGACCTCACTATCGTTCAAGCCGAAAACACATGGGT
GTCTTTATATTTGCAACAAAAAACCCTTTAGATTAAACCACAACCACTAGGTGAAATCACCATTAAACTACATCTAAACTATTAGCAAGCAAGACCCAAC
AATAATATCAACACATATTTGCTAAATCACACCCCAAGAATGGGGGTTTTTAGCCACACATCAAGAAATAACAAAATACACCTAAAATGATAGTAAAATG
AAGTGGGTATAAGAAATTAAACCTTAATTTAAGCAAAGGAAAAAGAATAGAGAAGACCCACTTCCAACTTGGGGAATATGAACTCCTTTCTCTAAGTTCC
CAAAAACCCTCTCCAAACTTGTGAGAAAATATCTAGAAAGTACTATTCTATTCTGGAAATTAAAATAAAAGTTTGACTCTTAAAAATAATAATAAGTTCA
GTATTTATAGACTTCAGAAAATAGCGCTGGCGGATCTTTCAGCGAAGTTAGTCGATGTTGCCGAATGAC
>RH008J10_T7_719685 (trimmed for quality and cloning vector)
GCATTCCTCTTGGACACCCATTTGCCGCATGAAGACCAGCCTACGCCTTACGCCACTCACTCTCTTGAGCTGAGTGTTAGGATTTGGGACTAGGGCTCAC
CCTCTCGGGCTGGACCTTATGTCGACCCACTCCTTAGGCCATCAGTCTAGTAGTCTTGGTTTCGCGACCTCACTATCGTTCAAGCCGAAAACACATGGGT
GTCTTTATATTTGCAACAAAAAACCCTTTAGATTAAACCACAACCACTAGGTGAAATCACCATTAAACTACATCTAAACTATTAGCAAGCAAGACCCAAC
AATAATATCAACACATATTTGCTAAATCACACCCCAAGAATGGGGGTTTTTAGCCACACATCAAGAAATAACAAAATACACCTAAAATGATAGTAAAATG
AAGTGGGTATAAGAAATTAAACCTTAATTTAAGCAAAGGAAAAAGAATAGAGAAGACCCACTTCCAACTTGGGGAATATGAACTCCTTTCTCTAAGTTCC
CAAAAACCCTCTCCAAACTTGTGAGAAAATATCTAGAAAGTACTATTCTATTCTGGAAATTAAAATAAAAGTTTGACTCTTAAAAATAATAATAAGTTCA
GTATTTATAGACTTCAGAAAATAGCGCTGGCGGATCTTTCAGCGAAGTTAGTCGATGTTGCCGAATGAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20
Sequence entropy
0.971727
Expected error %
not recorded
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone RH008J10
Clone
Clone name
rh-8j10
RH008J10
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Keygene Potato BAC library
Cloning vector
Organism
Solanum tuberosum
Restriction enzyme 1
HindIII
Accession
Restriction enzyme 2
EcoRI
Cloning host
E. coli
  

Other Reads:
1 sequencing reads found