Clone Read LE_HBa0146G15_T7_72125

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0146G15_T7_72125
Primer
T7
ID from Seq. Facility
LE_HBa_146_G15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
122 trimmed for vector and quality, 745 raw
Sequence
>LE_HBa0146G15_T7_72125 (raw untrimmed)
CATTGGATTGACCTTTCGTGAATTGGATGGTTATATGTGGGCAAATCTTTGCTAGATGGTTGCGCCCATGGAAAGGGGTGACGCTGGTTGGTAAAAGAGG
TAAGCTAAGC
CCAAGGTATATTCGGGCCATTTGAAGTACTTAAGCGAGTAGGGGAGGCGGCTTATGAATTAGCCTTGCCTCCAGGACTGTCAGGAGTGCA
TCCGGTGTTTCATGTGTCTATGTTGAAAAGATACCATGGGGATGGAAACTACCTTATCCGTTGGGATTCATTTTGGCTTGATGAGAATATGTCTTATGAG
GAGGAACCTGACTCCATTCTAGATAGAGAATATCGCTAGTTTAGATCCTGGTACATTGCACTCCTCCTATTGCATTGGCCGAATCTCTATTTCACAAACC
CGCTTACTCCTCAGATAGTTTACACATAATCTCCCCCCCCTCCGCTACACACGTATCTCCCCCCCTCTGACTCATTTTATACTATAATATCTTTTTACTA
TTACTTTTATCGTATCTCTCTACATTTTCCTTTTGACTTTTTTTTTACATGTTATTTTATACTTTTGCTTTCTTCTTTGTCGACCCTGCGTTGTTCTCGA
AGGTTCATGGAAATTCTATCTTAGACGTATATATTATAAATATATTATATTGCTACTTACAAAAATTAAATTCTACTCACACACTTTACATTATTATTCA
TATGCCTATTCACCTGTCTCTTCCCTCCTCTTAACCTCTCTCCTC
>LE_HBa0146G15_T7_72125 (trimmed for quality and cloning vector)
CCAAGGTATATTCGGGCCATTTGAAGTACTTAAGCGAGTAGGGGAGGCGGCTTATGAATTAGCCTTGCCTCCAGGACTGTCAGGAGTGCATCCGGTGTTT
CATGTGTCTATGTTGAAAAGAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.941475
Expected error %
1.29898
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0146G15
Clone
Clone name
hba-146g15
LE_HBa0146G15
C08HBa0146G15
P146G15
Clone type
BAC
Contamination
none
Estimated length
104,527
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found