Clone Read LE_HBa0146K09_T7_72305

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0146K09_T7_72305
Primer
T7
ID from Seq. Facility
LE_HBa_146_K09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
541 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0146K09_T7_72305 (raw untrimmed)
CCTTCGGTTAATTCGCGACGGCCCCGTTAATATAGATAGAAATGTAGAGAGAGGTGAGAACTTTTGGGCGCTTTCATTTGGGTATTTGATATGAGTGAGT
GAATATGATCTAAAAATGATTTAAAATAAATATATATACCTCCCATAAAATACCCAAAAGACCCCTCACTTATATTGACCATTCAATGAAGTCAAATTTA
TTTTTAACTTTCAGATTTTCATCATAAAATCTGTCCACGATGCGACGCAAACTTGATTTTTGACCAAAATCACACCAAGTAAACCACGTGGACAGACTTC
ATCTCTATGTATTTTGGTTGCTACTTTGGAATCTTGCTTGGCCAATTTTAACGTCATTTCATGGACCCTTAGGGCAACCTTTGGGAGAGCAGACCTGTCG
TTTTCAATCTATATACATGATTTTTTTATTAAAGTAATTTTACATGTTTTGAACCTCATACAACACCTCCAAACCTTAAAAAACCTAAGGACGTTTCACT
AGTTTAATTACACAAGCTTACGGATGTTATGGACGTTCCTTGATGTTTTGACTCTACAACATCCTAAATGGTTTATAAACATTATTTTAGGCTTAAAAAC
AATGTAACCAACCTTAGTTCCACATGTGACACTCTAGATTTGGTCTTGATCTTTTCAGAGTGTTTCATTTAAAATCTTTATATTGAAAAATAACTTTCTT
ATGATAATCGTATTCATGAAAACGTATGAATATGAAAAAAAATTCTAATAAAATCAAAATTGAACTAAATGTGTAATTTTCGTTCCGACAACGTTCTATA
ATTATTGATATCACACTATCACAAGACTATAGCTAAATGCCCTATTTATTAC
>LE_HBa0146K09_T7_72305 (trimmed for quality and cloning vector)
GAGAGGTGAGAACTTTTGGGCGCTTTCATTTGGGTATTTGATATGAGTGAGTGAATATGATCTAAAAATGATTTAAAATAAATATATATACCTCCCATAA
AATACCCAAAAGACCCCTCACTTATATTGACCATTCAATGAAGTCAAATTTATTTTTAACTTTCAGATTTTCATCATAAAATCTGTCCACGATGCGACGC
AAACTTGATTTTTGACCAAAATCACACCAAGTAAACCACGTGGACAGACTTCATCTCTATGTATTTTGGTTGCTACTTTGGAATCTTGCTTGGCCAATTT
TAACGTCATTTCATGGACCCTTAGGGCAACCTTTGGGAGAGCAGACCTGTCGTTTTCAATCTATATACATGATTTTTTTATTAAAGTAATTTTACATGTT
TTGAACCTCATACAACACCTCCAAACCTTAAAAAACCTAAGGACGTTTCACTAGTTTAATTACACAAGCTTACGGATGTTATGGACGTTCCTTGATGTTT
TGACTCTACAACATCCTAAATGGTTTATAAACATTATTTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94532
Expected error %
0.545562
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0146K09
Clone
Clone name
hba-146k9
LE_HBa0146K09
C02HBa0146K09
P146K09
Clone type
BAC
Contamination
none
Estimated length
129,363
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found