Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0146O12_SP6_72502

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0146O12_SP6_72502
Primer
SP6
ID from Seq. Facility
LE_HBa_146_O12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
624 trimmed for vector and quality, 823 raw
Genbank Accession
Sequence
>LE_HBa0146O12_SP6_72502 (raw untrimmed)
GATATCGTTGGTTTCAGTTTTAAGTTTTCAAATTTGATTCGTATGACACTANTTTGGAAAAAGTGATGTATTGATTTGATCCTATAATCAAGATTTTCAG
TAAAATTACTATCAAATTAGCAAATCATTTTTAAATATACTTATAACAAATGATATTAGTGCTCCCAAATGGTGAAGGAACAGTAAAGTTTCCTGTTTGA
TCATGAAACCCAAATCAGAAGCCCAAATCCCTTTTTAGGTTTATTTGGAAATTTCAAGCCCAAATAGCAACACAAAATACAATTCCAAAATGATCACGTC
CCGCCGATCACCAGGGTTGGTCGATTTACTTTCTCTCTAAAGAAGACGATCGACCGCTTCCCGGCGATTGTTAACGATCCTCTTCCCTTTTTTTAAGGCT
GCGAATTCTCTCTCTCCGGCGAAATCAAGCTTGTAAGTTTCTCCCTGCTGTTCTTTTTTCTAGATTTGTTGCTTTCATTTTTTCGGTAGATTATAAAAAA
AAGCCCTAATTTTTTTCAGTGATTTGTACTGGTGTTGTTGTGTTTTGAGTGAATTGGAGAAAAACTGTTTGTGTTTTGATGCAGATGCGAGATTCTTTTT
GACTGTTGCATAGCTATGTCGGTTAACAATAATAATAACCCTAACAAGAATATCGGAGGACCATCTTCCTTTGGCAATTCACCGCCGGGGAATCCGATGG
CACATCCTCCAGGCACAATCACAAGGCCCAGCACCAAATGCCTTCGGGGTTTCCTGGGGCATTTTCAACTTCCGCAACTATCTTCCTGCACATGCCCCAA
ACAATTTCTCAAACTTCATTCTA
>LE_HBa0146O12_SP6_72502 (trimmed for quality and cloning vector)
AGTTTTCAAATTTGATTCGTATGACACTANTTTGGAAAAAGTGATGTATTGATTTGATCCTATAATCAAGATTTTCAGTAAAATTACTATCAAATTAGCA
AATCATTTTTAAATATACTTATAACAAATGATATTAGTGCTCCCAAATGGTGAAGGAACAGTAAAGTTTCCTGTTTGATCATGAAACCCAAATCAGAAGC
CCAAATCCCTTTTTAGGTTTATTTGGAAATTTCAAGCCCAAATAGCAACACAAAATACAATTCCAAAATGATCACGTCCCGCCGATCACCAGGGTTGGTC
GATTTACTTTCTCTCTAAAGAAGACGATCGACCGCTTCCCGGCGATTGTTAACGATCCTCTTCCCTTTTTTTAAGGCTGCGAATTCTCTCTCTCCGGCGA
AATCAAGCTTGTAAGTTTCTCCCTGCTGTTCTTTTTTCTAGATTTGTTGCTTTCATTTTTTCGGTAGATTATAAAAAAAAGCCCTAATTTTTTTCAGTGA
TTTGTACTGGTGTTGTTGTGTTTTGAGTGAATTGGAGAAAAACTGTTTGTGTTTTGATGCAGATGCGAGATTCTTTTTGACTGTTGCATAGCTATGTCGG
TTAACAATAATAATAACCCTAACA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942451
Expected error %
0.365959
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0146O12
Clone
Clone name
hba-146o12
LE_HBa0146O12
C02HBa0146O12
P146O12
Clone type
BAC
Contamination
none
Estimated length
101,411
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found