Clone Read LE_HBa0146P12_T7_72551

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0146P12_T7_72551
Primer
T7
ID from Seq. Facility
LE_HBa_146_P12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
532 trimmed for vector and quality, 862 raw
Genbank Accession
Sequence
>LE_HBa0146P12_T7_72551 (raw untrimmed)
ATGTAACCGGTCCCGGTGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGAAAGGAATTACAAAGATGGCGCTTATTGAAATACATATATATACC
AAAATTAACTAGTAACCTATTTCTTAGCCATATCAAGAAGAAGCATAACAACTTTGTCCTCCTCTTTGGTGAGGCGACCCCTGAGTCTCGCCAAAGTCTT
CATATCACGAAGCCGCAGATCTTTCTTAGGAGAGGTTGGTACTGGAGACAGACCCAATTGATGAGAATTTGGTGAATCATTGTCACTTATGTTGGTAGAA
AAGATTTGTTGTTGGTGGTGAGTTGATGATAAGTCGATAGTAGTAGAACTTTCTGGTTGTTGAGAATTAGGAAATGGGACAAAAACTTTTTTTTGGTGGG
TTCCTTTAACCCTACCCTCCTTAAAATGAATCCTTGTATGGCCAGCTATGGCTTGGCTCGAAGAAAAGAGTTTATTACAGGTGATGCATTGAAACTTCCA
TATACCATGTAACTCAGTCTGTTCTTGCATTTTTTTTTTGTTTTAAGAAGGAGGAGGAGGAGGAGGAGGGAGAGGGGGAGGTNTTTTATAGTTGGTGTTT
GTGGTGTGTGTTTTGGGTTTTTTCTTACGTATGTTGTTTTATGTGTGGTGGTGGAAGATGTTTGATAGTTTGAGTTGTGTATGTGATGAGTTTTAAAGTT
GATTTTTATAGTATTATTGATTTTATGTTTGAGTTTGAGAATTGTATGATCTTTTATGTTTGTAGAGGGAGAGGGTGTTTGTTTTGTTTTTTTTTTTTAT
TTTGTGTTTTTGTTTGTGTTTGAGGTGAGTTGTTGTTGGAATTGTGTAAGTGTTGTGTTGCA
>LE_HBa0146P12_T7_72551 (trimmed for quality and cloning vector)
AGCTTTGAAAGGAATTACAAAGATGGCGCTTATTGAAATACATATATATACCAAAATTAACTAGTAACCTATTTCTTAGCCATATCAAGAAGAAGCATAA
CAACTTTGTCCTCCTCTTTGGTGAGGCGACCCCTGAGTCTCGCCAAAGTCTTCATATCACGAAGCCGCAGATCTTTCTTAGGAGAGGTTGGTACTGGAGA
CAGACCCAATTGATGAGAATTTGGTGAATCATTGTCACTTATGTTGGTAGAAAAGATTTGTTGTTGGTGGTGAGTTGATGATAAGTCGATAGTAGTAGAA
CTTTCTGGTTGTTGAGAATTAGGAAATGGGACAAAAACTTTTTTTTGGTGGGTTCCTTTAACCCTACCCTCCTTAAAATGAATCCTTGTATGGCCAGCTA
TGGCTTGGCTCGAAGAAAAGAGTTTATTACAGGTGATGCATTGAAACTTCCATATACCATGTAACTCAGTCTGTTCTTGCATTTTTTTTTTGTTTTAAGA
AGGAGGAGGAGGAGGAGGAGGGAGAGGGGGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960741
Expected error %
0.103213
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0146P12
Clone
Clone name
hba-146p12
LE_HBa0146P12
P146P12
Clone type
BAC
Contamination
none
Estimated length
51,804
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found