Clone Read LE_HBa0033P06_T7_7259

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0033P06_T7_7259
Primer
T7
ID from Seq. Facility
LE_HBa_033_P06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
812 trimmed for vector and quality, 858 raw
Genbank Accession
Sequence
>LE_HBa0033P06_T7_7259 (raw untrimmed)
ATACTCGGTCCCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTACAATCGAATGATCAATCTGAAAAAATAGATCCTTTTTATTAGACT
CCTCCCCAGGAGCTCTCACTTTATTTCTCTCTCGCTGATATGTATAATTAATTCGATAGTGAAACTTACCAAAGTTCTTAGTGATAATTTTTCTGTAAGA
GGATCAATGTCCAAAAAGGCTCCATAATTGGTTTTATCATATTCAAGGCCCACAGATGACCTGCATTTCAAAAAATTTACTCTCAATCTATAAATCTACA
AGTAGAAAACAAAAATTTATTGGTTATCAATGTAAAACCAAATCCAGGGTGATTTTTGTACCTTTTTTGGTCACAGCCCATTAACACAACAAACTTGTCA
TTCTTTTTGAAAATTCTAAAGAATATTGCTGTATATTCTTCAATTTTATTTGAGGCCAAAACTAGCAACCCAAAAGGTCCAACACCAGTGTTGGCTAATG
AACCACTTTGGTTAGCTATCTCTTGTGGATTCGTCCAATTTGATTCCAGCACCTCTGCCTGCTCAAGCACCGCAATTGGAATTGAGAAGGAGATTTCTAC
ATCAGCCTGTCGTATTATGAGTGTCAAATTAGCAAGTTGTTTTGAATTTGGACGAATAATATCAACAAAAGAAATTGACAAGCTTTTGCATAGGAAGAAT
TATACCTGTGCAGCAGTGACACCACAAATCTCACGTTTTAAACCAGCTTCGAGTGTTATATTTTGTAAATCAACTTTGTTTGTCCTCAGCATTTCGATTT
CTTCAACAGGCCATTGAACCAATTGCTTTCCACCTTTATCCAGCCAAATTTTCCTAGG
>LE_HBa0033P06_T7_7259 (trimmed for quality and cloning vector)
AGCTTTCTACAATCGAATGATCAATCTGAAAAAATAGATCCTTTTTATTAGACTCCTCCCCAGGAGCTCTCACTTTATTTCTCTCTCGCTGATATGTATA
ATTAATTCGATAGTGAAACTTACCAAAGTTCTTAGTGATAATTTTTCTGTAAGAGGATCAATGTCCAAAAAGGCTCCATAATTGGTTTTATCATATTCAA
GGCCCACAGATGACCTGCATTTCAAAAAATTTACTCTCAATCTATAAATCTACAAGTAGAAAACAAAAATTTATTGGTTATCAATGTAAAACCAAATCCA
GGGTGATTTTTGTACCTTTTTTGGTCACAGCCCATTAACACAACAAACTTGTCATTCTTTTTGAAAATTCTAAAGAATATTGCTGTATATTCTTCAATTT
TATTTGAGGCCAAAACTAGCAACCCAAAAGGTCCAACACCAGTGTTGGCTAATGAACCACTTTGGTTAGCTATCTCTTGTGGATTCGTCCAATTTGATTC
CAGCACCTCTGCCTGCTCAAGCACCGCAATTGGAATTGAGAAGGAGATTTCTACATCAGCCTGTCGTATTATGAGTGTCAAATTAGCAAGTTGTTTTGAA
TTTGGACGAATAATATCAACAAAAGAAATTGACAAGCTTTTGCATAGGAAGAATTATACCTGTGCAGCAGTGACACCACAAATCTCACGTTTTAAACCAG
CTTCGAGTGTTATATTTTGTAAATCAACTTTGTTTGTCCTCAGCATTTCGATTTCTTCAACAGGCCATTGAACCAATTGCTTTCCACCTTTATCCAGCCA
AATTTTCCTAGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957953
Expected error %
0.0573686
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g55120.1 Score 135 E Value 1e-37 Identity 46.40% Align. Length 703bp (86.58%) Frame 2
68414.m06295 beta-fructosidase, putative / beta-fructofuranosidase, putative similar to beta-fructofuranosidase GI:402740
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g13790.1 Score 129 E Value 6e-35 Identity 44.60% Align. Length 703bp (86.58%) Frame 2
68416.m01742 beta-fructosidase (BFRUCT1) / beta-fructofuranosidase / cell wall invertase identical to beta-fructofuranosidase GI:402740 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC81824.1| Score 127 E Value 1e-33 Identity 43.90% Align. Length 703bp (86.58%) Frame 2
invertase [Beta vulgaris]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD19322.1| Score 126 E Value 1e-33 Identity 43.90% Align. Length 703bp (86.58%) Frame 2
exocellular acid invertase 1 [Beta vulgaris]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0033P06
Clone
Clone name
hba-33p6
LE_HBa0033P06
P033P06
Clone type
BAC
Contamination
none
Estimated length
100,675
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found