Clone Read LE_HBa0147A16_SP6_72606

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147A16_SP6_72606
Primer
SP6
ID from Seq. Facility
LE_HBa_147_A16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
612 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0147A16_SP6_72606 (raw untrimmed)
AAATATCCACCTACAAACAGCAACCGCTTCAGGCATGGCCGGCGTCTGGTTTTGGTGAAGATGTGATCATCCGTGTACTCGACACTGTTTTAGGGCCAGA
ATCTGCTAGTTTCAGAGATGATGGACTCCTTTCAAGACCAAAAAGGTGGAAGGGAATTTGCAAGCCAGGAACAGATTTCAATTCTTCATTGTGCAACAGG
AAACTCATTGGAGCGAATTATTTCAATAAGGGGCTTTTGGCTAGCGATCCTACTATCGTCCTTTCCATGAATTCTGCAAGAGATACGAGAGGTCATGGCA
CTCATGTTGCTTCCATTGCTGCTGGTAGTCCTGTAAAAGGAGTTTCATATTTTGGATATGCTCCTGGAACAGCAAGAGGTATTGCGTCACGAGCTAGGCT
TGCTGTGTATAAGTTTAGCTTTGAAGAAGGGACTGTCACTTCTGATTTAATTGCTGCTATGGACCAAGCGGTTGCAGATGGCGTTGACGTAATATCAATT
TCTTATGGGTATGGATTTGGTCCACTGTATGAAGATGCTATTGCAATAGCTTCTTTTGGTGCCATGATGAAGGGTGTGTCAGTCTCTGCTTCAGCTGGGA
ATAATGGTCCTGAAATGGGAACTTTATCCAATGGATTCCCCTGGATCTTTACTGTGGCATCAGGCAGTACTGGACCGATCATTTTCGGGGGACTATAACT
TTAGGGAATGGCTTAAAGAATACTGGATTTAGCTTGTTTCCGAGGAAACCCAACAACCACCGATTTTAATTGGGTAACAATGGAATGCCTACCCCCTTGC
TAAACCATCTGAGGATTTAGCCCCCTACCCCCAATAAAAGAATGTGACACCCT
>LE_HBa0147A16_SP6_72606 (trimmed for quality and cloning vector)
GGCCGGCGTCTGGTTTTGGTGAAGATGTGATCATCCGTGTACTCGACACTGTTTTAGGGCCAGAATCTGCTAGTTTCAGAGATGATGGACTCCTTTCAAG
ACCAAAAAGGTGGAAGGGAATTTGCAAGCCAGGAACAGATTTCAATTCTTCATTGTGCAACAGGAAACTCATTGGAGCGAATTATTTCAATAAGGGGCTT
TTGGCTAGCGATCCTACTATCGTCCTTTCCATGAATTCTGCAAGAGATACGAGAGGTCATGGCACTCATGTTGCTTCCATTGCTGCTGGTAGTCCTGTAA
AAGGAGTTTCATATTTTGGATATGCTCCTGGAACAGCAAGAGGTATTGCGTCACGAGCTAGGCTTGCTGTGTATAAGTTTAGCTTTGAAGAAGGGACTGT
CACTTCTGATTTAATTGCTGCTATGGACCAAGCGGTTGCAGATGGCGTTGACGTAATATCAATTTCTTATGGGTATGGATTTGGTCCACTGTATGAAGAT
GCTATTGCAATAGCTTCTTTTGGTGCCATGATGAAGGGTGTGTCAGTCTCTGCTTCAGCTGGGAATAATGGTCCTGAAATGGGAACTTTATCCAATGGAT
TCCCCTGGATCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971641
Expected error %
0.703077
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g67090.1 Score 208 E Value 2e-54 Identity 19.00% Align. Length 608bp (99.35%) Frame 1
68418.m08459 subtilase family protein contains similarity to subtilisin-like protease ag12 GI:757522 from [Alnus glutinosa]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g67360.1 Score 201 E Value 3e-52 Identity 17.20% Align. Length 608bp (99.35%) Frame 1
68418.m08494 cucumisin-like serine protease (ARA12) Asp48; almost identical to cucumisin-like serine protease (ARA12) GI:3176874 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA07001.1| Score 327 E Value 1e-88 Identity 26.10% Align. Length 608bp (99.35%) Frame 1
subtilisin-like protease [Lycopersicon esculentum] emb|CAA06997.1| subtilisin-like protease [Lycopersicon esculentum] pir||T07169 subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA07059.1| Score 320 E Value 2e-86 Identity 25.60% Align. Length 608bp (99.35%) Frame 1
SBT4B protein [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147A16
Clone
Clone name
hba-147a16
LE_HBa0147A16
P147A16
Clone type
BAC
Contamination
none
Estimated length
131,420
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found