Clone Read LE_HBa0147A16_T7_72607

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147A16_T7_72607
Primer
T7
ID from Seq. Facility
LE_HBa_147_A16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
622 trimmed for vector and quality, 923 raw
Genbank Accession
Sequence
>LE_HBa0147A16_T7_72607 (raw untrimmed)
ATAAACTGGACCCGGGGGGACCCTCTGAAGTCGACCTGCAGGCATGCAAGCTTCCAATGTTGTATTAGTATGTTCCCTTTAAGGGAATAATAGGATTTGC
CAGTAGATGTCTTAAAGCCTTTATGTGTTCATCCTATTTGTTCCTATCTTTCAATCCTCGAGTTTCAAATATAGTTTGTATAATATTCTCAGGTTGTGTT
TAAGTCGTTAAGTCTTGTACGTATTTATAGTCGTGTTTAAGTCGTTAACTCTTGAAGGTATTTATAGTCTCCCGAGATAACAACAGGGTATATTTTATTT
CAAAATATAACATAGGGTATAAGTGATCTACTTCGCATAATCAAAGGCAATTTGCACTACTCTTTTAAATTTAAATATTTCTTATTTTCACCATCTTCAT
CAAATTTAGCAATCGAAGTTTCGATAAATATCATTTTTGTAAATTTTTACTGTGTTTTTTATTCATAGAAATCATTATTGAGTTTGGACAGCCAAGTACT
ACAACAACAACGACTAATTATATTCCCTAAAGATGATTTCAAATGACAACCAATTCCACCTAAGTCTTAATTAAGAAAATAATTACAACTAATTTTACGA
TAATTAATATGACTACATAAATTAAAAAAAAAATGTGATGGAGAGGTTGAACAACACCATTTTACATAAAAAATTTAATAAGCAGTGGATAATTTATAAT
CTGACACCCAACCACCAATTACTATTTTTGGAAATATACTAATTAGTTAGGCTTCTTAATTTCACTCTAATTGATTGGGAAGCAAATTTCAAACTCGTAA
AATTAAGCAAGTTTTTGGATATTTACAGATTACAAGATAAACTTGTGAAACATCGGGCTACTACTACTCAAATACTAGTTCCGCAGAGCCAATCCAATCC
TATACATTCCAAATCATTCTACC
>LE_HBa0147A16_T7_72607 (trimmed for quality and cloning vector)
AGTCGACCTGCAGGCATGCAAGCTTCCAATGTTGTATTAGTATGTTCCCTTTAAGGGAATAATAGGATTTGCCAGTAGATGTCTTAAAGCCTTTATGTGT
TCATCCTATTTGTTCCTATCTTTCAATCCTCGAGTTTCAAATATAGTTTGTATAATATTCTCAGGTTGTGTTTAAGTCGTTAAGTCTTGTACGTATTTAT
AGTCGTGTTTAAGTCGTTAACTCTTGAAGGTATTTATAGTCTCCCGAGATAACAACAGGGTATATTTTATTTCAAAATATAACATAGGGTATAAGTGATC
TACTTCGCATAATCAAAGGCAATTTGCACTACTCTTTTAAATTTAAATATTTCTTATTTTCACCATCTTCATCAAATTTAGCAATCGAAGTTTCGATAAA
TATCATTTTTGTAAATTTTTACTGTGTTTTTTATTCATAGAAATCATTATTGAGTTTGGACAGCCAAGTACTACAACAACAACGACTAATTATATTCCCT
AAAGATGATTTCAAATGACAACCAATTCCACCTAAGTCTTAATTAAGAAAATAATTACAACTAATTTTACGATAATTAATATGACTACATAAATTAAAAA
AAAAATGTGATGGAGAGGTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.932445
Expected error %
1.09735
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147A16
Clone
Clone name
hba-147a16
LE_HBa0147A16
P147A16
Clone type
BAC
Contamination
none
Estimated length
131,420
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found