Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0147D05_T7_72729

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147D05_T7_72729
Primer
T7
ID from Seq. Facility
LE_HBa_147_D05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
691 trimmed for vector and quality, 931 raw
Genbank Accession
Sequence
>LE_HBa0147D05_T7_72729 (raw untrimmed)
TTTAACTTGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTTTGTAACTTTTTGCTTTTTCGTTTTTTGTGCTGTCTTTTGGATT
CCTCATACACAGTTAATATAAACTTTGAAGTGCCCTCATACACAGTTAATATAAACTTTGAAGTGCATATAGGAAAAAAAACACTTTTTTTTCATAAGTG
GATGTGTATTTTTATCATTATTAAAGATTATCCTAAAATGCCACTTTAATTAGACAAATACTAATGGACCTTCCTGCTAAGTATATTAAATGTGTACTAC
TTATTCTAAATACCCCTTTAGCAATAGTATTGGTAAAGTTGTTTCTGTGTTACCTATAGATTTGACTTCGAGTCGTGTTCTTAGTCATTCATGTTTGTGT
CAGTATAAGTTGTCTATATCACACCTTCTAAGGATATGGTCCTTCCCTGAACCTACGTGAACGTGAAATGTTTTCTGCACTGAGCTGTCAAACTATAGTA
TAGTATATCACATATATATAACACTTAACACAGTAAGTTTCTTGATACATAAACTAGTTCAATCTTCTTTCTTTCGTTAGTATGTGGTTTCTCAAAAAGT
GGTCTCTTCTACTAAGTACTCTTCCTTTACAGCTATATAATTTTGTGAGGATGAAAAGTTTTTCAAGAATCATTCTCACATAGTTGAAATGCTTTTATTT
TTATGTTAATATGAATAGGATGAGATGATTCGCGATACTATGGAAAACGTTGAATTTCAGGCTAATAAGTTGATTGAAGAAGAAATGCATCATGAAGAAT
CCTCACCAGTTATGCGAGATTCCAAGGTAATGAATTGACTTGTACATTCATTGTTCCACACATTTGAACTAGTATAGCATGTATCCCTTGTGTCCTAAAG
GCCGAGTTGCGTTAGGCCATTCTAGAACTGG
>LE_HBa0147D05_T7_72729 (trimmed for quality and cloning vector)
AGCTTTTTTTGTAACTTTTTGCTTTTTCGTTTTTTGTGCTGTCTTTTGGATTCCTCATACACAGTTAATATAAACTTTGAAGTGCCCTCATACACAGTTA
ATATAAACTTTGAAGTGCATATAGGAAAAAAAACACTTTTTTTTCATAAGTGGATGTGTATTTTTATCATTATTAAAGATTATCCTAAAATGCCACTTTA
ATTAGACAAATACTAATGGACCTTCCTGCTAAGTATATTAAATGTGTACTACTTATTCTAAATACCCCTTTAGCAATAGTATTGGTAAAGTTGTTTCTGT
GTTACCTATAGATTTGACTTCGAGTCGTGTTCTTAGTCATTCATGTTTGTGTCAGTATAAGTTGTCTATATCACACCTTCTAAGGATATGGTCCTTCCCT
GAACCTACGTGAACGTGAAATGTTTTCTGCACTGAGCTGTCAAACTATAGTATAGTATATCACATATATATAACACTTAACACAGTAAGTTTCTTGATAC
ATAAACTAGTTCAATCTTCTTTCTTTCGTTAGTATGTGGTTTCTCAAAAAGTGGTCTCTTCTACTAAGTACTCTTCCTTTACAGCTATATAATTTTGTGA
GGATGAAAAGTTTTTCAAGAATCATTCTCACATAGTTGAAATGCTTTTATTTTTATGTTAATATGAATAGGATGAGATGATTCGCGATACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.928493
Expected error %
0.268531
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147D05
Clone
Clone name
hba-147d5
LE_HBa0147D05
C08HBa0147D05
P147D05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found