Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0147G09_SP6_72880

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147G09_SP6_72880
Primer
SP6
ID from Seq. Facility
LE_HBa_147_G09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
433 trimmed for vector and quality, 888 raw
Genbank Accession
Sequence
>LE_HBa0147G09_SP6_72880 (raw untrimmed)
GCTCTCCGTGAATTTAGGTGGTCTCTCCTTATCATCTTTTTGGCTTTTGTGAGAGCTATATACCATTTCTGCCTGTAAATCCGACATAACTGCATTCTCT
TCCTCCGCCAAGCGGGTTCTGCTGGTTTCTTTTTCTCTGATATGTCAACTTTTGCATGTTTCCTAGGCCTACCCCTCCCCCTTCCAGATTTTGTTTGTTT
ACCTTTCTTGCGTCCTATTTTTTTGTTTTGCACAACTACAAATTTAGCCCTCCTTGCAGAACGTCTGAGGGGCATAACCACAGGCTTCTTTTTGCTACTT
GGCGACTGTGCTGGCTGTTTATTTTTGGTGCCTCCAGATATAACCTTTAAGCGCATCGGCCTCAAGGCTTTTGATGCTTCCTCACTCTTCTGCATCTCTA
TCCTCCCCCTCTTCACATTCTTCCTCACATTATTCACATCCATACACTTGTGACATGTATGCTTAAACTCAGCAGCAACGACTCCAGTGGACTTTCTAAC
ATGTCTTTTATGGAAAAAACCTGAATAAATCGACGAATACCAAACCATTTGCATTAAATGTGGACAATATGCAAGGGGTGTTTCATGTGTTGAAGCGCCA
TAGTGGGAATGATATTTAGTACCTTTTTAATTTTGGATGTATTTGAATTGAAAATACGTAAGGTAGCTTAATTTACTAATCTTCTTGATATTGCTTATCT
TTAACTATCTTATTTGTTTTGAACTTTCTTGGGCTGTATTTATCTTATTTATTAAACAAAAATTGTTTGATTCTTTGTTTTTCTTGAATTGTATGGATTT
TTTGTTTATTTTGTATTTTATTTTGGATAGTCGAGGTTTTTTGTGTTGTTTTATATGAGATTAATTGTTGCGTATATCGTCGTTGTTT
>LE_HBa0147G09_SP6_72880 (trimmed for quality and cloning vector)
ACATAACTGCATTCTCTTCCTCCGCCAAGCGGGTTCTGCTGGTTTCTTTTTCTCTGATATGTCAACTTTTGCATGTTTCCTAGGCCTACCCCTCCCCCTT
CCAGATTTTGTTTGTTTACCTTTCTTGCGTCCTATTTTTTTGTTTTGCACAACTACAAATTTAGCCCTCCTTGCAGAACGTCTGAGGGGCATAACCACAG
GCTTCTTTTTGCTACTTGGCGACTGTGCTGGCTGTTTATTTTTGGTGCCTCCAGATATAACCTTTAAGCGCATCGGCCTCAAGGCTTTTGATGCTTCCTC
ACTCTTCTGCATCTCTATCCTCCCCCTCTTCACATTCTTCCTCACATTATTCACATCCATACACTTGTGACATGTATGCTTAAACTCAGCAGCAACGACT
CCAGTGGACTTTCTAACATGTCTTTTATGGAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.938824
Expected error %
0.804168
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147G09
Clone
Clone name
hba-147g9
LE_HBa0147G09
P147G09
Clone type
BAC
Contamination
none
Estimated length
113,732
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found