Clone Read LE_HBa0147J04_T7_73015

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147J04_T7_73015
Primer
T7
ID from Seq. Facility
LE_HBa_147_J04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 862 raw
Genbank Accession
Sequence
>LE_HBa0147J04_T7_73015 (raw untrimmed)
GGATAACTCGGTACCGAGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCCAACAAGAACTATTTACCCCTTTAATGGTTTCTTGCAATGAGA
GTCAACTACATTCTGGGCATTGCACCTACCAAGAAACCCCACTAGTTGCTGGTGGTACATATGTTCTCAAGCATAACTCAAGGTAAATAATTACCAGGAG
ACCAAGGTTTACCGTAAGAGATACATCCAATGATACCAAAATCCAGCTTGGTCTAACTGAATTTCGAAGTAATTGGACAAGAGAAATACTAATTCACTAA
AGATTGTATCCTGCAGTAGAACGAAAACTAAGATAAGTATTCCAACAGTATACAGTATACACTCCATCTCTATGATCATCAACAGGTAACTAGATGTATC
AATCAATCAAACACACCTCAATCTGAAACTAGTTTCCACGCATCTAGTACAAAAAAAAAATACGAACCAGATTATTCAGCAGAAAATATAACCCCGTAAC
CACGGATGCCTCAATGGCAAGTAAAACTGACAAGCAGGACAAGTAAAACTGACAAGCACCAAACTGAAATATTTATGCATACTCTATCCTCATTATTTTA
CATCTTTTTTCAAGCATAGATTTTGCAGCATCAGTCATCATAATTCGGTAGCACCCCATATTAACTAGCTCTTTGAAAAACAATGTTCCCAACATTGAAA
AGTAATGAGATTAATGGTTCTGATTGCACATGCATTCAGCCAACATCATTTTCTGGCTGAATACAGACATAGTGTACCTTCATTCATTCTTTCATCTTTC
GTTGCCCAAATGGTACCATTGCAAAAAATAAATGTCATTCTAAGTAGGGGAAATGAAAGATG
>LE_HBa0147J04_T7_73015 (trimmed for quality and cloning vector)
AGCTTCTCCAACAAGAACTATTTACCCCTTTAATGGTTTCTTGCAATGAGAGTCAACTACATTCTGGGCATTGCACCTACCAAGAAACCCCACTAGTTGC
TGGTGGTACATATGTTCTCAAGCATAACTCAAGGTAAATAATTACCAGGAGACCAAGGTTTACCGTAAGAGATACATCCAATGATACCAAAATCCAGCTT
GGTCTAACTGAATTTCGAAGTAATTGGACAAGAGAAATACTAATTCACTAAAGATTGTATCCTGCAGTAGAACGAAAACTAAGATAAGTATTCCAACAGT
ATACAGTATACACTCCATCTCTATGATCATCAACAGGTAACTAGATGTATCAATCAATCAAACACACCTCAATCTGAAACTAGTTTCCACGCATCTAGTA
CAAAAAAAAAATACGAACCAGATTATTCAGCAGAAAATATAACCCCGTAACCACGGATGCCTCAATGGCAAGTAAAACTGACAAGCAGGACAAGTAAAAC
TGACAAGCACCAAACTGAAATATTTATGCATACTCTATCCTCATTATTTTACATCTTTTTTCAAGCATAGATTTTGCAGCATCAGTCATCATAATTCGGT
AGCACCCCATATTAACTAGCTCTTTGAAAAACAATGTTCCCAACATTGAAAAGTAATGAGATTAATGGTTCTGATTGCACATGCATTCAGCCAACATCAT
TTTCTGGCTGAATACAGACATAGTGTACCTTCATTCATTCTTTCATCTTTCGTTGCCCAAATGGTACCATTGCAAAAAATAAATGTCATTCTAAGTAGGG
GAAATGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955903
Expected error %
0.488224
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147J04
Clone
Clone name
hba-147j4
LE_HBa0147J04
C03HBa0147J04
P147J04
Clone type
BAC
Contamination
none
Estimated length
88,547
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found