Clone Read LE_HBa0147N04_SP6_73206

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0147N04_SP6_73206
Primer
SP6
ID from Seq. Facility
LE_HBa_147_N04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
683 trimmed for vector and quality, 784 raw
Genbank Accession
Sequence
>LE_HBa0147N04_SP6_73206 (raw untrimmed)
GATTTAAAACTCGAAAATATGACTAAGTTAGTTCACCTTAAAAAAACAGGGCATCATAGTTCTACAAAACCCTTTAGGAATCTAATGTATGATAAAAATC
AAAATAATAAGCAATTATCAATGCACATACTCGCAGCTCAAATTCTGGTATAAGCTGTATATCCTAAACTTCATACTGCAAGTGAAAATAATATTAAAAC
GAATGAGGTGAAGAAACTCCAAGCTAAACCTACCACAATATAAGACTAAAATGAAGAAATTCAGAAAGTTCATTCCGTCAAAAAAATCGTATATGAACAA
AAAGAAGATATGAAAGAAGACCAACTAAAATGAAGAAATTCAGAATTTGATTCCAACAGAAAACCCATTCATGAATATGAATAGAAAAAGTTCAAAAGAA
ATATGATGAAAGAAGACCAACTTAGTTACTGCATGTGAGAAAAAATTGAAATTATTGAAAAGCACAACAAAAATTGAACATCAACAACAAATCCAAATGA
AAAAAAGAGAGAAATATCAACATACCCAAATCAAATTTGGTCAAAGAAAAATGAAATTAGGGAATACTTTTTAATGAACTATTAATTTTTAAGAACAACA
AGATACTCAAAAAATCAAAGAAACATTATGAAGAAGTTTACCTAGAAATTCAAATGAATGCTACACAGGGGAAATTTTGATTAGCATATGAAGAAGAAGC
AAGACAGTAAACAATGAGGGGTGCCATATGAGTAAGACACGTAGCTATATTTGAGCACTAAAAAGATAAAAAAAATCCTTAGGT
>LE_HBa0147N04_SP6_73206 (trimmed for quality and cloning vector)
ATGACTAAGTTAGTTCACCTTAAAAAAACAGGGCATCATAGTTCTACAAAACCCTTTAGGAATCTAATGTATGATAAAAATCAAAATAATAAGCAATTAT
CAATGCACATACTCGCAGCTCAAATTCTGGTATAAGCTGTATATCCTAAACTTCATACTGCAAGTGAAAATAATATTAAAACGAATGAGGTGAAGAAACT
CCAAGCTAAACCTACCACAATATAAGACTAAAATGAAGAAATTCAGAAAGTTCATTCCGTCAAAAAAATCGTATATGAACAAAAAGAAGATATGAAAGAA
GACCAACTAAAATGAAGAAATTCAGAATTTGATTCCAACAGAAAACCCATTCATGAATATGAATAGAAAAAGTTCAAAAGAAATATGATGAAAGAAGACC
AACTTAGTTACTGCATGTGAGAAAAAATTGAAATTATTGAAAAGCACAACAAAAATTGAACATCAACAACAAATCCAAATGAAAAAAAGAGAGAAATATC
AACATACCCAAATCAAATTTGGTCAAAGAAAAATGAAATTAGGGAATACTTTTTAATGAACTATTAATTTTTAAGAACAACAAGATACTCAAAAAATCAA
AGAAACATTATGAAGAAGTTTACCTAGAAATTCAAATGAATGCTACACAGGGGAAATTTTGATTAGCATATGAAGAAGAAGCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.884909
Expected error %
0.265782
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0147N04
Clone
Clone name
hba-147n4
LE_HBa0147N04
P147N04
Clone type
BAC
Contamination
none
Estimated length
76,190
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found