Clone Read LE_HBa0152A18_SP6_73378

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0152A18_SP6_73378
Primer
SP6
ID from Seq. Facility
LE_HBa_152_A18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
739 trimmed for vector and quality, 844 raw
Genbank Accession
Sequence
>LE_HBa0152A18_SP6_73378 (raw untrimmed)
GTTTAAAGAGTTGACCGGCACTAAGCAAAGAAAGGATGAGCAAGTGGTGGATTACATCAATCGATGGAGATCCTTTTGTTTGGACTGCAAAGATCGTCTT
TCTAAAATAGCTACCCTTGAAATGTGCATTCAGGGCATGTATTGNGGGACTTTTATACAAACTACAAGGAATCAAACCGCGATTCTTTGAGGAACTTGTT
ACATGAGCACATGACATGGAGTTGAGCATCATAAGTTATGGGAAGGCATCTCTTTTGGCTGATCTAACAAAGCAAGAGAAGGACTTCAAAAAAGGTATGA
CCTCAAAGATCCAGACTAAGGAATCTATGGCGGTTAAAGCAACTTCAGTAAAATGTACCTCTAAGAGTAAACTAAAAGAGGAGGAATATCCCCAAGTCAA
TATCTAAGAGAGGAGAGACGACGTCCAACCTTGAATGAATTAGAGGTAAAGGTATACCCATTTTCCGATTCAGATGTACCTATGATTCTTGAGGAATTGC
TAGCTAAGAAGGTTATTAATATTCCCGAGTCAAAGAGGCCTGAAGAGATCAACAAGGTTGATGATCCTAGATATTGCAAGTTCTATCCCGTCCTTGGCCA
CCCTACAAGTAAATGTTTTATCTTGAAAGAGAAGATCATGATGTTGGTAAGTGAAGGAAAAATCATCATTGACCAAGATGAATTTGCGGAGGCAAATCAT
GCTAGTGTAGCACCAAATCAAAGAAGTGCTCAAGGTCGTCATCTATTCCAAACACCACCCTTCTTACAGTTTGAAAAGTTTAAGCTCCCATTTGAATTTG
ATATTCCAAAGGAAAAACTCTTTGAGGGTCCCACTAAAAGATAA
>LE_HBa0152A18_SP6_73378 (trimmed for quality and cloning vector)
GCACTAAGCAAAGAAAGGATGAGCAAGTGGTGGATTACATCAATCGATGGAGATCCTTTTGTTTGGACTGCAAAGATCGTCTTTCTAAAATAGCTACCCT
TGAAATGTGCATTCAGGGCATGTATTGNGGGACTTTTATACAAACTACAAGGAATCAAACCGCGATTCTTTGAGGAACTTGTTACATGAGCACATGACAT
GGAGTTGAGCATCATAAGTTATGGGAAGGCATCTCTTTTGGCTGATCTAACAAAGCAAGAGAAGGACTTCAAAAAAGGTATGACCTCAAAGATCCAGACT
AAGGAATCTATGGCGGTTAAAGCAACTTCAGTAAAATGTACCTCTAAGAGTAAACTAAAAGAGGAGGAATATCCCCAAGTCAATATCTAAGAGAGGAGAG
ACGACGTCCAACCTTGAATGAATTAGAGGTAAAGGTATACCCATTTTCCGATTCAGATGTACCTATGATTCTTGAGGAATTGCTAGCTAAGAAGGTTATT
AATATTCCCGAGTCAAAGAGGCCTGAAGAGATCAACAAGGTTGATGATCCTAGATATTGCAAGTTCTATCCCGTCCTTGGCCACCCTACAAGTAAATGTT
TTATCTTGAAAGAGAAGATCATGATGTTGGTAAGTGAAGGAAAAATCATCATTGACCAAGATGAATTTGCGGAGGCAAATCATGCTAGTGTAGCACCAAA
TCAAAGAAGTGCTCAAGGTCGTCATCTATTCCAAACACC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.973916
Expected error %
0.707558
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0152A18
Clone
Clone name
hba-152a18
LE_HBa0152A18
P152A18
Clone type
BAC
Contamination
none
Estimated length
107,384
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found