Clone Read LE_HBa0152M22_SP6_73962

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0152M22_SP6_73962
Primer
SP6
ID from Seq. Facility
LE_HBa_152_M22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
457 trimmed for vector and quality, 718 raw
Genbank Accession
Sequence
>LE_HBa0152M22_SP6_73962 (raw untrimmed)
TACGTAAAAGCACAAATTAACGGTAATAGACAAACTTACCTCTAGGAATATTCCCTTGCAATTTGTTCGCCATAAAGATACAGACCTTGGAGTTGGAGCT
TACCGACTTCAGATGGAATGGCTCCCATCAAGTTTTTATCCTCAAATGCTAGCGACATTAGACCGCTCATGTTTCCTATACTTGTGGGAATGAGGCCACT
GATTTGTGCACTTCCCACGTGAATTATTCCAATATTTTTGGGTATTTCTCCAGTTATCTTGTTGAAAGATATGGACAACGCTTTGAGCTCTGCGAGCTGG
CAAATGTTGGAAGGAATGTTGCCAGAAATTTGGTTGTTAGATATTGCTAAGGACTCTAGATTTGACACAATGTTCCCTTCATCATTTAAGAAAGGGCCGG
AAAGGCTATTGAATGCTAGAGATGCGACAAGAAGCGAGGAGATATTAAATAGTGCTGCAGGAATTGAACCTGTTAATTGGTTATCTAACAAGGACAAAAA
TTCAATTTGGCTGATATTACCAATTTCCTTTGGAATGTTCCCACCAACTCTATTCCCATTCAAACTGAAGTCCAACAACTTTTTTGGCCATTTTTATTAG
GATGAGGGATTATGCCTGGTGAGGTTATGTTTCCCTGAGATTTATCCAGGGGCTCTTTCCTCATTTCACCCCCGATTTTTTCTGAAACCCAATGAATTTA
TTTAAAACCCCCTGGTTN
>LE_HBa0152M22_SP6_73962 (trimmed for quality and cloning vector)
GGAATATTCCCTTGCAATTTGTTCGCCATAAAGATACAGACCTTGGAGTTGGAGCTTACCGACTTCAGATGGAATGGCTCCCATCAAGTTTTTATCCTCA
AATGCTAGCGACATTAGACCGCTCATGTTTCCTATACTTGTGGGAATGAGGCCACTGATTTGTGCACTTCCCACGTGAATTATTCCAATATTTTTGGGTA
TTTCTCCAGTTATCTTGTTGAAAGATATGGACAACGCTTTGAGCTCTGCGAGCTGGCAAATGTTGGAAGGAATGTTGCCAGAAATTTGGTTGTTAGATAT
TGCTAAGGACTCTAGATTTGACACAATGTTCCCTTCATCATTTAAGAAAGGGCCGGAAAGGCTATTGAATGCTAGAGATGCGACAAGAAGCGAGGAGATA
TTAAATAGTGCTGCAGGAATTGAACCTGTTAATTGGTTATCTAACAAGGACAAAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968628
Expected error %
0.752085
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g27060.1 Score 94 E Value 4e-20 Identity 42.50% Align. Length 401bp (87.75%) Frame 2
68418.m03229 disease resistance family protein contains leucine rich-repeat (LRR) domains Pfam:PF00560, INTERPRO:IPR001611; similar to Hcr2-0B [Lycopersicon esculentum] gi|3894387|gb|AAC78593
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g46330.1 Score 91 E Value 4e-19 Identity 38.80% Align. Length 401bp (87.75%) Frame 2
68418.m05703 leucine-rich repeat transmembrane protein kinase, putative
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC15780.1| Score 94 E Value 9e-19 Identity 41.40% Align. Length 398bp (87.09%) Frame 2
Cf-2.2 [Lycopersicon pimpinellifolium]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC15779.1| Score 94 E Value 9e-19 Identity 41.40% Align. Length 398bp (87.09%) Frame 2
Cf-2.1 [Lycopersicon pimpinellifolium] pir||T10504 disease resistance protein Cf-2.1 - currant tomato prf||2207203A Cf-2 gene
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0152M22
Clone
Clone name
hba-152m22
LE_HBa0152M22
P152M22
Clone type
BAC
Contamination
none
Estimated length
108,270
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found