Clone Read LE_HBa0153J21_SP6_74584

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0153J21_SP6_74584
Primer
SP6
ID from Seq. Facility
LE_HBa_153_J21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
186 trimmed for vector and quality, 868 raw
Sequence
>LE_HBa0153J21_SP6_74584 (raw untrimmed)
CCCGACGATCGGAGTAGTCTTGTAGCCGTCGGATAACGACATTGAGCAATAGTCATAGGGATTTTTCGGAAATGTTATCCAGCAGACCTCAGTCTGGTTA
AGTTTACAATTTTGAAGCAGTTAAAGCATCCACGAAGAATTTCAGTCCTGCATGTTTGATTGAGGGATCTGTGTGTCGGGGCACGATAAATGGGGATTTT
GCTGCTAGAAGCAAAATGAGTGGTGATGTATCAAAGGAAATTAATTTGTTGAGCAAAATGA
ATCATTTTAATCTTATTAGTCTATCGGGAATTTGTTTTC
TTGATGGTCACTGGTATCTTGTATATGAGTATGCTGCCTATGGACCATTAAGTGATTGGATATGTCGCCATAATGGTGAGCAGAAGTCACTAAGTTGGTC
ACAAAGAGTACAAATTTCTTTTTATGTGGCTACAGGACTTAACTATCTCCATAGCTACACATGCCCACCTCATGTTCACAAGGATTTAGACGGTGATAAT
ATACTTGTTGATGGTGATTTAACAGCCAAGATTGCTAACTTTGCTGCTAGCAGGGTCAGCGGATGGACAAGAAGGTGACTTTGCATTGACAACGCACATA
GTGTGGGACCCAAGGCTACATGGCAGCTGAGTAGTTTGAGAATGGGCTAGTGTCACCGAATCAGGATGTCTATGCATTGGGATTCTGTTGCTGGAGTTCT
CACCGGGAAGAGTTTCCCTTTATATGACGTTCAACACAACTTGCTGATTGTTATCCCGGNCTTATGATATAATCAAGGGAGTTGACAACTCTTGACCTTC
CTGCAGGAGACCTGTGACTTCTTTCCAGTCAATGTCGAAATGCTATAAAACCTCCTCCCCAAACGTAG
>LE_HBa0153J21_SP6_74584 (trimmed for quality and cloning vector)
ATCATTTTAATCTTATTAGTCTATCGGGAATTTGTTTTCTTGATGGTCACTGGTATCTTGTATATGAGTATGCTGCCTATGGACCATTAAGTGATTGGAT
ATGTCGCCATAATGGTGAGCAGAAGTCACTAAGTTGGTCACAAAGAGTACAAATTTCTTTTTATGTGGCTACAGGACTTAACTATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942035
Expected error %
2.36966
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g23770.1 Score 68 E Value 9e-13 Identity 17.50% Align. Length 182bp (97.85%) Frame 1
68415.m02839 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein contains Pfam domains, PF00069: Protein kinase domain and PF01476: LysM domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g33580.1 Score 64 E Value 2e-11 Identity 16.40% Align. Length 182bp (97.85%) Frame 1
68415.m04115 protein kinase family protein / peptidoglycan-binding LysM domain-containing protein protein kinase [Arabidopsis thaliana] GI:2852449; contains Pfam profiles PF01476: LysM domain, PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC17086.1| Score 68 E Value 7e-11 Identity 17.50% Align. Length 182bp (97.85%) Frame 1
putative protein kinase [Arabidopsis thaliana] ref|NP_179957.1| protein kinase family protein / peptidoglycan-binding LysM domain-containing protein [Arabidopsis thaliana] pir||T02414 probable protein kinase [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0153J21
Clone
Clone name
hba-153j21
LE_HBa0153J21
C02HBa0153J21
P153J21
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found