Clone Read LE_HBa0154A04_SP6_74886

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0154A04_SP6_74886
Primer
SP6
ID from Seq. Facility
LE_HBa_154_A04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
753 trimmed for vector and quality, 889 raw
Genbank Accession
Sequence
>LE_HBa0154A04_SP6_74886 (raw untrimmed)
TGGGGGCCCAGGTTTAGCTAGCTCCTTAAACTGCACAAGAGAACAACTGGTTGTCAGATTAGCATAATAACACCACCCAAAGACCATTAATCAACAACAG
GGACCATTCAAAAAAGTGTAGCTTCTCACTGGCTTATCAGCCAAGAAGACAACAACTCCAAACACAACCACCATCATGAGGAGGGAGCAACTTAAGATTA
CATCAAACAAACATAACAAAAAAATAGCACCACCAACACACAAAAAGGAAAAGGAAAATAACAATAGGAGATGATGAAAAGAAAAAAAGGCTATCCTTCA
GGATCACCACCCTTGTCAGGTATTCAGGAGGTTCATCTAAGCAGCTTTACTTAACAAAACCAGTATTCAGGTTCATCTAAGCAGCTTTACAATACAAAAC
CAACAGATACATGGAACTCTAAGAAGCAACTCAACTAAAACACTTGCACAGCCTAAAAACACCACCTTGATGAGCAAACAAAACAGCATAGCAATAAAAA
AGGCACCACCCCAACACATAAAAGAGATAAACCAGCTCAACAAGCATTCTTCCTCCCCCTCCCCAAAAAACGAAATCTTAGGACCACCATTGGCTGGCTA
ACTGAATTTTCAGGCTATCAGTGAGAACTTGATTCCCCATAATTCCTCTTCATAAGAACCTCCTTGGCTGGCAAACTGAATGTGAGAGCTTGATTCCCCA
CCTTATGATCCCTCTTCCCCTTCCCCCAGTATATTTCTTCCCAAATTGAAACTAAGAACTGCCATTCTTCAAGAAACAATGGATGAAACAAGGATATAGC
AGGGAGCAGGAGATGGTACAGAATTTAAAATGTACCTCAACTAAAACATTTACCCACCAATAACTCAGCCTTTGGCAACTCTTCAGCTA
>LE_HBa0154A04_SP6_74886 (trimmed for quality and cloning vector)
GAGAACAACTGGTTGTCAGATTAGCATAATAACACCACCCAAAGACCATTAATCAACAACAGGGACCATTCAAAAAAGTGTAGCTTCTCACTGGCTTATC
AGCCAAGAAGACAACAACTCCAAACACAACCACCATCATGAGGAGGGAGCAACTTAAGATTACATCAAACAAACATAACAAAAAAATAGCACCACCAACA
CACAAAAAGGAAAAGGAAAATAACAATAGGAGATGATGAAAAGAAAAAAAGGCTATCCTTCAGGATCACCACCCTTGTCAGGTATTCAGGAGGTTCATCT
AAGCAGCTTTACTTAACAAAACCAGTATTCAGGTTCATCTAAGCAGCTTTACAATACAAAACCAACAGATACATGGAACTCTAAGAAGCAACTCAACTAA
AACACTTGCACAGCCTAAAAACACCACCTTGATGAGCAAACAAAACAGCATAGCAATAAAAAAGGCACCACCCCAACACATAAAAGAGATAAACCAGCTC
AACAAGCATTCTTCCTCCCCCTCCCCAAAAAACGAAATCTTAGGACCACCATTGGCTGGCTAACTGAATTTTCAGGCTATCAGTGAGAACTTGATTCCCC
ATAATTCCTCTTCATAAGAACCTCCTTGGCTGGCAAACTGAATGTGAGAGCTTGATTCCCCACCTTATGATCCCTCTTCCCCTTCCCCCAGTATATTTCT
TCCCAAATTGAAACTAAGAACTGCCATTCTTCAAGAAACAATGGATGAAACAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.926586
Expected error %
0.189517
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0154A04
Clone
Clone name
hba-154a4
LE_HBa0154A04
P154A04
Clone type
BAC
Contamination
none
Estimated length
111,485
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found