Clone Read LE_HBa0154J19_SP6_75348

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0154J19_SP6_75348
Primer
SP6
ID from Seq. Facility
LE_HBa_154_J19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 1000 raw
Sequence
>LE_HBa0154J19_SP6_75348 (raw untrimmed)
AAATGGTATTACGTACACCGTACATGATTGGGGGGGGCCTCCTCTTACACCAGGTTTAGCATTTTTATTCGCAATTGTGGATTTATTTAGGTGCCAATAT
TATTAATTGCACGTGGTTTGTGTTTAAGAAGAATTGTCTCACTATATAACGAGCACGGGGTTTCGACCCATCCCACTGCATCCCCGTCGCTCACAGCCGA
CCGGCGCGGGCGCACATGCACCACGCGACGCCGAACGCAANCACGAGTACCCACACGCTCGTCACCTTACGATCGCGTACTTTATACGTATTAGTGTCGG
TCGATGTAGCGTTGGTAGGGTGAGTACCACTGCGAGTATTGAGGGACGAGCGCGAACGACGATGGAGNGATGNTGCATGGGTGGTCAGGACTTTATGAGC
GGTGTTTGAGAGTTGGTGANTTGTGTGTTATGCAAGAGTAGAAGGAGACATATCGAAGGTATTAGGATGCCTATACTTATCGAGAGTGATACGACGTCTG
ATATCAAATAAAGAGTCACCAAAGTTACAGACGTCTCCCACACGAGTCCAATTAGATGACATTCACAATGTTCAACACTACNTCGCCGTGATNTANCGCT
TTACTGCAGNTCACGACATAACGGCGGTCGAATNCGACGAGATTGAGTTATGTGTGATAGCGTTCGTGATTGCTATCGCGTATAACATACGCGATCACTC
GTCAACTCGTGTCACTTAATAAGGAAATT
ACATGCAGCTCGCACTCTTCNCTACACNGTCGCTTCGCGCTGTAGTAACGATTAGCTAAAGCATGTGTAAG
NGTGTGACTATGTGCCTTATCTTACACTCTGATGACTTTCTACCAACAAATTACTACTAACTGCGTCACCATATCACACTAGGAAGTACTGATACGCTAT
CACATAACAAGCGTGCATTATTCCTCTAGGATGCCACGTATCGTCACATATATTCTTNCTTGCGTCGGCTTGCTTACATATAATCCCNCTCCTCACTGCG

>LE_HBa0154J19_SP6_75348 (trimmed for quality and cloning vector)
AC

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
3.3129
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0154J19
Clone
Clone name
hba-154j19
LE_HBa0154J19
P154J19
Clone type
BAC
Contamination
none
Estimated length
101,656
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found