Clone Read LE_HBa0154L10_T7_75427

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0154L10_T7_75427
Primer
T7
ID from Seq. Facility
LE_HBa_154_L10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
818 trimmed for vector and quality, 898 raw
Genbank Accession
Sequence
>LE_HBa0154L10_T7_75427 (raw untrimmed)
TTTAACCTGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTGCCTCATTTCTGCAGGCCTTTAATGTTTGTGGTTATTTAGGA
AATGCCAATTGTAGTTCTTAGTTGGGCAGTCAAGATATGAGTTGGTCTCACTCTAGCCGTCGTTTTATTTTCGTTTGTACAATTTATGAAATTTTGTACC
TTTATGCTGTATCAAAGGTTTATTATGTTCTATATGTACCATCTTTTTATAATTCCTGCAGTATCCAACATCTGAAAGAATAAAAGACTGTTTGAATTTC
GAATGCGGATGCCATACTGGGACTAAAGCGCCACAGAATTGGTTGCAGCTTGTAACCATTTATTTCTCGTTCCCTTCTTCTTTCTTTTTGGGGAACTTGA
CACCTAACTGATTAACATCTATAAAGTGTCATCTTGAAAATTGGATATTCAGTACAGAATCATCTTGTTCCCTATGCAAAGGAAAGTTATACAACATATT
GTATTACACAACCTCTGCTATTTTATTTTTCCTCTTTGTGTAGATTGCAGAGTGAACCATGTTTATTCGTGCTTTGCTACTATCATCTGCGTCAAATGCA
AATAAAGCTACTGGTAGGAAGGACTCCATAGAAACGTAAACAGCTCAACGATGAAACTGCAATCCACTGATAGTGATCCTCTTGTAAAACATATATGGAT
AACAGAAATCTCTCTGTTGCAATACACGTGACATAAACATTTTGTATGTTTCCTGAATACAAAGATATGAAGGTCAACCTTAAACATGGTTCCCTCTACT
GATCACACAAAGTTATAAAGATATGATAACGAGGAGAATTTGACTGAAAAAGATGAAGAAATCAGAATTGACGATGAACTTCCCAGAAACAATTCCTA
>LE_HBa0154L10_T7_75427 (trimmed for quality and cloning vector)
AGCTTTTGTTGCCTCATTTCTGCAGGCCTTTAATGTTTGTGGTTATTTAGGAAATGCCAATTGTAGTTCTTAGTTGGGCAGTCAAGATATGAGTTGGTCT
CACTCTAGCCGTCGTTTTATTTTCGTTTGTACAATTTATGAAATTTTGTACCTTTATGCTGTATCAAAGGTTTATTATGTTCTATATGTACCATCTTTTT
ATAATTCCTGCAGTATCCAACATCTGAAAGAATAAAAGACTGTTTGAATTTCGAATGCGGATGCCATACTGGGACTAAAGCGCCACAGAATTGGTTGCAG
CTTGTAACCATTTATTTCTCGTTCCCTTCTTCTTTCTTTTTGGGGAACTTGACACCTAACTGATTAACATCTATAAAGTGTCATCTTGAAAATTGGATAT
TCAGTACAGAATCATCTTGTTCCCTATGCAAAGGAAAGTTATACAACATATTGTATTACACAACCTCTGCTATTTTATTTTTCCTCTTTGTGTAGATTGC
AGAGTGAACCATGTTTATTCGTGCTTTGCTACTATCATCTGCGTCAAATGCAAATAAAGCTACTGGTAGGAAGGACTCCATAGAAACGTAAACAGCTCAA
CGATGAAACTGCAATCCACTGATAGTGATCCTCTTGTAAAACATATATGGATAACAGAAATCTCTCTGTTGCAATACACGTGACATAAACATTTTGTATG
TTTCCTGAATACAAAGATATGAAGGTCAACCTTAAACATGGTTCCCTCTACTGATCACACAAAGTTATAAAGATATGATAACGAGGAGAATTTGACTGAA
AAAGATGAAGAAATCAGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961741
Expected error %
0.845999
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0154L10
Clone
Clone name
hba-154l10
LE_HBa0154L10
P154L10
Clone type
BAC
Contamination
none
Estimated length
51,816
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found