Clone Read LE_HBa0154O22_SP6_75594

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0154O22_SP6_75594
Primer
SP6
ID from Seq. Facility
LE_HBa_154_O22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
742 trimmed for vector and quality, 859 raw
Genbank Accession
Sequence
>LE_HBa0154O22_SP6_75594 (raw untrimmed)
CGGGGCCCTGGGTGGATTATCTTTCCACATCAATGTGATCTCAATCCCGATTAGGAGTCATATAATTTTGCCACCAACTCCAAACCACCACAAGGGTTCT
TCTACCATTATGTACTATGTTGACAAGAAACTAACGATACACTATAATATATCCTTTGTTGCACATCCCATAACGGACGAAGAACTTATGAGTTCTATTC
TGTTCAGGCTAGACTCTTCCTACGTCCCTTTTCACTCTTCCATTAATACTCACCTTGATAACCTCACCACTAACTCAGTTCTTGGTTTATTTTTCTAAGA
AAAAGAGAAAATGTCTAAGGAAACCAAATCCCTCAAACTTCAAGATAATGCCATATCTTGTCAATACTCCATCCGCTCACTAATCACTGGATATCCTAAT
CAATTAAGTTTTATAACCTCTCAAAAACCCTCTAGGCGCCCTACCAACAACAACCATTTTCGTTCTTCTTGTAGATCATCACCTCGCATAAATTGTCAAA
TATGTGAAAAACCCAACCACCATGCTCGTAATTGCTTCAACCAAACAACATGGATACCTACCTACCTAATTGATCCGCGAACTATCCAAAAGACAATATG
GTTACTCCCTAGACTCATTTTATGATCTCTCCTTCTGCTATTGTTGATAATTCATGGTTTTCAGATGCAGGTTCCACCAATCATGTTACGTTGAACTTGT
CTCAACTATCCATTCGCACAGACTATAATTGTGAGGACTAGCTTGTTGTAGGTAATATCCCAAAAACTCTCTATTAATCACATCGTTTCATCTAAGCTTC
CTTGTGCTACTCGACCACCTCATCTTAATAAAATCCTCAGGTTCCTTCATCACCAAGAT
>LE_HBa0154O22_SP6_75594 (trimmed for quality and cloning vector)
GATCTCAATCCCGATTAGGAGTCATATAATTTTGCCACCAACTCCAAACCACCACAAGGGTTCTTCTACCATTATGTACTATGTTGACAAGAAACTAACG
ATACACTATAATATATCCTTTGTTGCACATCCCATAACGGACGAAGAACTTATGAGTTCTATTCTGTTCAGGCTAGACTCTTCCTACGTCCCTTTTCACT
CTTCCATTAATACTCACCTTGATAACCTCACCACTAACTCAGTTCTTGGTTTATTTTTCTAAGAAAAAGAGAAAATGTCTAAGGAAACCAAATCCCTCAA
ACTTCAAGATAATGCCATATCTTGTCAATACTCCATCCGCTCACTAATCACTGGATATCCTAATCAATTAAGTTTTATAACCTCTCAAAAACCCTCTAGG
CGCCCTACCAACAACAACCATTTTCGTTCTTCTTGTAGATCATCACCTCGCATAAATTGTCAAATATGTGAAAAACCCAACCACCATGCTCGTAATTGCT
TCAACCAAACAACATGGATACCTACCTACCTAATTGATCCGCGAACTATCCAAAAGACAATATGGTTACTCCCTAGACTCATTTTATGATCTCTCCTTCT
GCTATTGTTGATAATTCATGGTTTTCAGATGCAGGTTCCACCAATCATGTTACGTTGAACTTGTCTCAACTATCCATTCGCACAGACTATAATTGTGAGG
ACTAGCTTGTTGTAGGTAATATCCCAAAAACTCTCTATTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956694
Expected error %
0.0298497
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0154O22
Clone
Clone name
hba-154o22
LE_HBa0154O22
P154O22
Clone type
BAC
Contamination
none
Estimated length
92,618
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found