Clone Read LE_HBa0154O22_T7_75595

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0154O22_T7_75595
Primer
T7
ID from Seq. Facility
LE_HBa_154_O22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
706 trimmed for vector and quality, 892 raw
Genbank Accession
Sequence
>LE_HBa0154O22_T7_75595 (raw untrimmed)
CCTAACCCGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAAAGCTCTCTACGGGTTAACACTAGCTCCAAGGGCATGGTATG
ATAGATTGTCAAAATTCCTTTTAAGTCATGGATATTCAAGAGGAAAAATTGATAATACACTCTTCTTCAAGAATAAAGAAAAGGGTCTCCTGATAGTACA
AATCTATGTTGACGATATCATATTTGGAGCTACAAATAAGAGTCACAAAAGAATTTGCAAATCTTATGAGCAATGAGTTTGAAATGAGTATTATGGGTGA
ATTAAACTACTTTCTTGGGCTACAAATAAAACAAACACCTGGAGGTACATGGATTCATCAACAAAAATATGTAAAAGAATTGCTTAAGAGGTTCAAAATG
GATGATGCTAAACCAATTGATACTCCAATAGACCCTGCCACTAAGTTGGACCTTGAAGGAACAGGTTCTGCTGTTGAACAAAAACTGTATAGAGGCATGA
TTGGCTCACTTTTATATCTTACTGCTAGTCGACCTGATATTGTGTTTAGTGTAGGATTATGTGCTCGCTTTCAAACTAATCCTAAAGAATCACATATTCA
AGCAGTCAAGAGAATCCTCAGATATCTAAAAGGAACCTCTGATTTAGGACTTTGGTACCCAAAAGGAAGCAACTTTGATTTAGTTGGGTATGCGGATGCT
GACTATGCTGGATACTTTGGGTGATAGAAAAAGCACTACAGGAATGGCTCACTTTCTAGGAATCTGCCTTATCTCATGGGGATCAAAGAAAAAAAACTCA
GTTGCACTATCCACTGCTGAATCTAAGTACGTAGCAGCTGCGTTCTGTTGCCCAAACCTTCTTTGAATAAGCACAACTTAGTGATTTCGTCT
>LE_HBa0154O22_T7_75595 (trimmed for quality and cloning vector)
AGCTTGACAAAGCTCTCTACGGGTTAACACTAGCTCCAAGGGCATGGTATGATAGATTGTCAAAATTCCTTTTAAGTCATGGATATTCAAGAGGAAAAAT
TGATAATACACTCTTCTTCAAGAATAAAGAAAAGGGTCTCCTGATAGTACAAATCTATGTTGACGATATCATATTTGGAGCTACAAATAAGAGTCACAAA
AGAATTTGCAAATCTTATGAGCAATGAGTTTGAAATGAGTATTATGGGTGAATTAAACTACTTTCTTGGGCTACAAATAAAACAAACACCTGGAGGTACA
TGGATTCATCAACAAAAATATGTAAAAGAATTGCTTAAGAGGTTCAAAATGGATGATGCTAAACCAATTGATACTCCAATAGACCCTGCCACTAAGTTGG
ACCTTGAAGGAACAGGTTCTGCTGTTGAACAAAAACTGTATAGAGGCATGATTGGCTCACTTTTATATCTTACTGCTAGTCGACCTGATATTGTGTTTAG
TGTAGGATTATGTGCTCGCTTTCAAACTAATCCTAAAGAATCACATATTCAAGCAGTCAAGAGAATCCTCAGATATCTAAAAGGAACCTCTGATTTAGGA
CTTTGGTACCCAAAAGGAAGCAACTTTGATTTAGTTGGGTATGCGGATGCTGACTATGCTGGATACTTTGGGTGATAGAAAAAGCACTACAGGAATGGCT
CACTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948665
Expected error %
0.427604
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 103 E Value 1e-30 Identity 36.20% Align. Length 654bp (92.63%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM94552.1| Score 212 E Value 5e-70 Identity 66.90% Align. Length 657bp (93.06%) Frame 1
putative polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAP54118.1| putative polyprotein [Oryza sativa (japonica cultivar-group)] ref|NP_921831.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31277.1| Score 211 E Value 7e-70 Identity 65.80% Align. Length 660bp (93.48%) Frame 1
putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0154O22
Clone
Clone name
hba-154o22
LE_HBa0154O22
P154O22
Clone type
BAC
Contamination
none
Estimated length
92,618
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found