Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0157E06_SP6_75850

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157E06_SP6_75850
Primer
SP6
ID from Seq. Facility
LE_HBa_157_E06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
527 trimmed for vector and quality, 833 raw
Genbank Accession
Sequence
>LE_HBa0157E06_SP6_75850 (raw untrimmed)
GTTTTTAGAGGGGACTATGGCCTTTTAGGCCGCGGATGTTTGAGGCAATAACAGGTCTGTGATGCGCTTACCTTTTAAGGGCCGCACGCGCGCTACACTG
ATTATTCAACGCCCTTATAGGCTTGGCCAACAGGCCCGGGTAATCTTTGAAATTTCATCGTGATAGGGATATATCATTGCATTTATTCGTTTTCAACGAG
GAATTCCTAATAAGCGCGAGTCATCAGCTCCCGTTGACTACGTCCATGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATTGAATGATTTAGTGACAT
TTTTGGATCGCGGCGACATGGGCGGTTCGCTGCCCGCGAAGTCGTGAGAAGTCCATTTAACCTTATCATTTAGAGGAAGGAGAAGTCGTAAAAAGGTTTC
CATAGGTGAACCTACGGAAGGATCATTGTCTAAACCTGTACCGCAGAACGACCTGCGAACTCATTTTAAACACCTGGGGGTGGCGCTCGCTCGTTGTGCC
CCTCCCTCCTATCGCCCGACACGCGCAAGCTCTTCAGGCGTCTATCTTACCCCTGCTCGTATATATTCTTCAAATACTTCAATCGACAGCCCTCCCCTCC
CGCCCTGTTCACAGCTCATGGGGGGATGCTCGCTGCTCTGATAACACAAACTACTCTCGACAACGAATATCTCAGCTCTCGTATCGATGAAGAAAGGAGC
AAAATGCCGATGCTAGGTGTGAATCGAGGATCCCCTGAACCATCTATGTCTTGAAATCAAGTTCCCCCCAAAACAATTTTGGCCCAAAAAAATGACGGCC
TGGGTCGGCAGGCTTTGGGTTTTCCTCCCCCTG
>LE_HBa0157E06_SP6_75850 (trimmed for quality and cloning vector)
GGACTATGGCCTTTTAGGCCGCGGATGTTTGAGGCAATAACAGGTCTGTGATGCGCTTACCTTTTAAGGGCCGCACGCGCGCTACACTGATTATTCAACG
CCCTTATAGGCTTGGCCAACAGGCCCGGGTAATCTTTGAAATTTCATCGTGATAGGGATATATCATTGCATTTATTCGTTTTCAACGAGGAATTCCTAAT
AAGCGCGAGTCATCAGCTCCCGTTGACTACGTCCATGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATTGAATGATTTAGTGACATTTTTGGATCGC
GGCGACATGGGCGGTTCGCTGCCCGCGAAGTCGTGAGAAGTCCATTTAACCTTATCATTTAGAGGAAGGAGAAGTCGTAAAAAGGTTTCCATAGGTGAAC
CTACGGAAGGATCATTGTCTAAACCTGTACCGCAGAACGACCTGCGAACTCATTTTAAACACCTGGGGGTGGCGCTCGCTCGTTGTGCCCCTCCCTCCTA
TCGCCCGACACGCGCAAGCTCTTCAGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.987739
Expected error %
0.393787
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157E06
Clone
Clone name
hba-157e6
LE_HBa0157E06
C02HBa0157E06
P157E06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found