Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0157E06_T7_75851

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157E06_T7_75851
Primer
T7
ID from Seq. Facility
LE_HBa_157_E06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 825 raw
Genbank Accession
Sequence
>LE_HBa0157E06_T7_75851 (raw untrimmed)
CCTCGGTTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCCCTTATTTTCACTGCTTTCCTTTAAAGGTNCACTTTTAGGATCACGATA
GGACTTTCTTCCTTTTTAATATAGGCTCAGGGTTAGGTAGGGTATATTTAGGTATACTTTAATGACTTTTTTCCCTTCTTGACATATCGGCTAAACATAC
CTCTTTCCATCATTTTATTTCTCCCAATTTCCCATATTCTTTTACCTTGCTATTTTCCCTTCTTTCTTCATTTGTGTAAGTAACTCTCTTCTTTTCTTGC
TTGTATTTATTGTATTTTTTTTATTTCACTTTTCTTTCAACTGATTCTTGAGTCACTTTACTTTTGTTCTTGCTCTCTCTTTGTTCTTTTAACCCTACTT
TCCAGAGCATTCCTCATAATAGACACCCTCAATTCATGGCTTTGCCATGAGTCAAAGTACATGATACCCAAAGTTGGGTCAGGGCCATAAAAAGGTTGTT
TACTGCATTAGCCACCCTTAACTTATGCTTTTGGCATAAGCTGAGGTACACATGTCCAAGGAGGGACTAAGGCCAACTCATTATACCAAGAAAAGATCAG
TTGGGGTGAAAAAGAAAGGTCTAGTTTAAGCTCAAATCATTTGGATCAAAGAAGGATTAATTTCATTTGTTTTTTTATTTAGGCTAAAAATGAGCTATTT
TGAAACAGGGCCTATGATCTTTTACTAATTGTCTATTACAGCTTATTTTTATCAGGACTAACCTGGCAACTTTCTAGCTCAGTATAAATAGTGTACTATT
CAAATCTTCCTTCCTCTCATCTGAA
>LE_HBa0157E06_T7_75851 (trimmed for quality and cloning vector)
AGCTTGCCCTTATTTTCACTGCTTTCCTTTAAAGGTNCACTTTTAGGATCACGATAGGACTTTCTTCCTTTTTAATATAGGCTCAGGGTTAGGTAGGGTA
TATTTAGGTATACTTTAATGACTTTTTTCCCTTCTTGACATATCGGCTAAACATACCTCTTTCCATCATTTTATTTCTCCCAATTTCCCATATTCTTTTA
CCTTGCTATTTTCCCTTCTTTCTTCATTTGTGTAAGTAACTCTCTTCTTTTCTTGCTTGTATTTATTGTATTTTTTTTATTTCACTTTTCTTTCAACTGA
TTCTTGAGTCACTTTACTTTTGTTCTTGCTCTCTCTTTGTTCTTTTAACCCTACTTTCCAGAGCATTCCTCATAATAGACACCCTCAATTCATGGCTTTG
CCATGAGTCAAAGTACATGATACCCAAAGTTGGGTCAGGGCCATAAAAAGGTTGTTTACTGCATTAGCCACCCTTAACTTATGCTTTTGGCATAAGCTGA
GGTACACATGTCCAAGGAGGGACTAAGGCCAACTCATTATACCAAGAAAAGATCAGTTGGGGTGAAAAAGAAAGGTCTAGTTTAAGCTCAAATCATTTGG
ATCAAAGAAGGATTAATTTCATTTGTTTTTTTATTTAGGCTAAAAATGAGCTATTTTGAAACAGGGCCTATGATCTTTTACTAATTGTCTATTACAGCTT
ATTTTTATCAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.926885
Expected error %
0.953016
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157E06
Clone
Clone name
hba-157e6
LE_HBa0157E06
C02HBa0157E06
P157E06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found