Clone Read LE_HBa0157J23_SP6_76124

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157J23_SP6_76124
Primer
SP6
ID from Seq. Facility
LE_HBa_157_J23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
393 trimmed for vector and quality, 800 raw
Genbank Accession
Sequence
>LE_HBa0157J23_SP6_76124 (raw untrimmed)
ATTAAGGTGAGGCTAGACTTCCATGCTTCCCGCCTTTCTGCTTAAAGCATCCGCTACAACATTCGTCTTCCCCTTTATGAACAAAATAGTGATGTCGTAG
TCCTTCAGTAGTTCCTTCCATCTCCTCTGTCTCAAGTTCAAATCTTTCTGAGTAAAGACATACTGTAGGCTACGATGATCCGTATAGACCTCACACTTAA
CCCCATATAAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCGGCCAATTCCAAATCATGAGTTGGATAGTTACGTTCATGTACTTTTAATTGTCT
TGAAGCATAAGCAATCACATTCTTCTCATGCATTAGCACTGCACCCAAACCCGAATAGGATGCATCACAATAGACAATGAAATTCTTACCTTCCACTGGC
AAGGTGAGAATTGCTGCAGTAGTCAACAGAGTCTTGAGCTTCTGAAAACTTTCCTCACACTCTTCCGACCATATTTTTGGAACATTTTGCTTAGTCAAGT
TCGTCACTTGGGAAGCAATAGAAGATAATCCCTTGACTAATCCGCTGGTCTACTTAGTGTATTCAACTAAGTTCTCTTTTTTTTGACACATTTACTATGT
ATTACTCCCCTCTATTACTGTTTCCATCCTAAAAAAAACCCTGCTATCACTTCCATCCCAAAATTCCCACTTGTCCCCTTAAAGCGACTTTACAATGTGA
TCCTATACTGTTCTTCTCAATAGTAATTTGCGCCATGCATTTATTTCTCCTCTATCTCCTTAAACTACTATGGTTCATTACTTGGTCCTTTTTATATATC

>LE_HBa0157J23_SP6_76124 (trimmed for quality and cloning vector)
GCTTCCCGCCTTTCTGCTTAAAGCATCCGCTACAACATTCGTCTTCCCCTTTATGAACAAAATAGTGATGTCGTAGTCCTTCAGTAGTTCCTTCCATCTC
CTCTGTCTCAAGTTCAAATCTTTCTGAGTAAAGACATACTGTAGGCTACGATGATCCGTATAGACCTCACACTTAACCCCATATAAATAGTGTCTCCATT
GCTTTAATGCAAACACTACCGCGGCCAATTCCAAATCATGAGTTGGATAGTTACGTTCATGTACTTTTAATTGTCTTGAAGCATAAGCAATCACATTCTT
CTCATGCATTAGCACTGCACCCAAACCCGAATAGGATGCATCACAATAGACAATGAAATTCTTACCTTCCACTGGCAAGGTGAGAATTGCTGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968986
Expected error %
0.387006
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 213 E Value 1e-54 Identity 26.20% Align. Length 392bp (99.75%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 211 E Value 7e-54 Identity 26.00% Align. Length 392bp (99.75%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157J23
Clone
Clone name
hba-157j23
LE_HBa0157J23
P157J23
Clone type
BAC
Contamination
none
Estimated length
130,238
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found