Clone Read LE_HBa0157J23_T7_76125

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157J23_T7_76125
Primer
T7
ID from Seq. Facility
LE_HBa_157_J23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
506 trimmed for vector and quality, 819 raw
Genbank Accession
Sequence
>LE_HBa0157J23_T7_76125 (raw untrimmed)
ACCGGGGACCGGGGGGAATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAATAGAATAGAAGAGAAGAGCCTTTAATCACAATTCCACTACTACCCCA
CTTAAAAAAACCCACCTCAACTCAAGGAGAAAATTATAACTTACCAACATCATCATCCAACTATGTTCCTTGTTAGTTCCCTTCAACTCTTGTTGGGACC
CTTACCAAGTACCTTCAAGGTCTCATATACACATCATAAGATCATATGCCACTCATAAGGTAAACACTTATATAAACCTAACTCATGAACATTAAGACAA
TTAACCAGCCTTACTACTAGGCATAACACCCTTCTCTTGGAATCTAATACTAGACAAACTTTTATAGATATTACATCCTTAAATTCAAAATAAGCATCAA
AACTCCTCTCTTTCTCCTTCAAACCTGGCAACATTTGTCAAATCCGGGGAGCACCCCATAAATGTAATGGCGGCGATGGCCTCGAAGAGGACTAAGACTA
GACTCGGCGGCTGCCTCGAAGAGGACTAACACTAGACTCTTAGCATTAATCGTTACACTACTTTATGATGTTTACTTAATACCTTTCGATTACACTTAAT
ATATCTCTATTAGAGTATACATACTACCCTTTCATATAAGATATATTACTATATCCTTTCTTTTTATACTGTGCAGACTTATGATAAATGAATATCATTT
ACTTCTTTCGTTCAAATTGATTTGCTCTTTTAATCTAATCTCTTTTATATTATACTACACTTCATTTATAATTTTTATATGTCTTTTTGTATTTATATTT
GTTTTGAATAACTATATTT
>LE_HBa0157J23_T7_76125 (trimmed for quality and cloning vector)
AGTCGACCTGCAGGCATGCAAGCTTGAATAGAATAGAAGAGAAGAGCCTTTAATCACAATTCCACTACTACCCCACTTAAAAAAACCCACCTCAACTCAA
GGAGAAAATTATAACTTACCAACATCATCATCCAACTATGTTCCTTGTTAGTTCCCTTCAACTCTTGTTGGGACCCTTACCAAGTACCTTCAAGGTCTCA
TATACACATCATAAGATCATATGCCACTCATAAGGTAAACACTTATATAAACCTAACTCATGAACATTAAGACAATTAACCAGCCTTACTACTAGGCATA
ACACCCTTCTCTTGGAATCTAATACTAGACAAACTTTTATAGATATTACATCCTTAAATTCAAAATAAGCATCAAAACTCCTCTCTTTCTCCTTCAAACC
TGGCAACATTTGTCAAATCCGGGGAGCACCCCATAAATGTAATGGCGGCGATGGCCTCGAAGAGGACTAAGACTAGACTCGGCGGCTGCCTCGAAGAGGA
CTAACA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953071
Expected error %
0.57337
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157J23
Clone
Clone name
hba-157j23
LE_HBa0157J23
P157J23
Clone type
BAC
Contamination
none
Estimated length
130,238
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found