Clone Read LE_HBa0157O23_T7_76365

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157O23_T7_76365
Primer
T7
ID from Seq. Facility
LE_HBa_157_O23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
500 trimmed for vector and quality, 805 raw
Genbank Accession
Sequence
>LE_HBa0157O23_T7_76365 (raw untrimmed)
CCCCGGACCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGATGCAAAGGCTGTGAAGTGCCATTCATAAGCTATGGTTGTGATTTGTTTG
GTTACAGGTTTTCGGATGACAAGAATAGAAAGATCCTGAGACATAGTGATGTGACATTTGATCAGTCTGTCCTGTACAAGGACATAGAGCAGAAGGTTCT
AGAGATTACAAAACAAGTGGGAGTTGAGGTTGAAATGGAGAAGAGTAACCCAGAGATGTCGAAGCAGATACTCAATCAACTCCTACTGAAGAATCTGAAG
TGGAGCAAGTTACACCTGAGCAGGTGCTAAGGAGATCATCCAGAACCATCAGGGCACCAGATAGGTATTCACCTTCATCACACTTGGTATTCACCTTCAT
TGCACTATCTATTGCTGACTGATGAGGGGGAACCAGAATCTTTTGATGAGGCCCTACAGGTGAAGGATTCGATCAAGTGGGAGCAAGCCATGGATGATGC
GATGAGGTCACTTGAGAAGAATGACACATGGGTGTTGACTGAGTTACCTGCATGGAAGATAGCCTTGCTGAACAAGTTGGTGTTTAAGTAATAAAACTGA
ACTCATATTGGAAATATAATGTTAAAGGGTTCTCTAATTGCTCTAATGTCTACCTTATATGTTATCTGCTTTATTTTTTTTTTTTATTTCTTTTCTTTCT
TTTAGTTTATAAAACACTTATTTGTTTCTTCTTGTATAACTGTATTTTTTTATACTCTGTTCGTATTTAGCAGCTTCTTTTAATTCTTTAGAATATATTT
CTTGT
>LE_HBa0157O23_T7_76365 (trimmed for quality and cloning vector)
AGCTTGATGCAAAGGCTGTGAAGTGCCATTCATAAGCTATGGTTGTGATTTGTTTGGTTACAGGTTTTCGGATGACAAGAATAGAAAGATCCTGAGACAT
AGTGATGTGACATTTGATCAGTCTGTCCTGTACAAGGACATAGAGCAGAAGGTTCTAGAGATTACAAAACAAGTGGGAGTTGAGGTTGAAATGGAGAAGA
GTAACCCAGAGATGTCGAAGCAGATACTCAATCAACTCCTACTGAAGAATCTGAAGTGGAGCAAGTTACACCTGAGCAGGTGCTAAGGAGATCATCCAGA
ACCATCAGGGCACCAGATAGGTATTCACCTTCATCACACTTGGTATTCACCTTCATTGCACTATCTATTGCTGACTGATGAGGGGGAACCAGAATCTTTT
GATGAGGCCCTACAGGTGAAGGATTCGATCAAGTGGGAGCAAGCCATGGATGATGCGATGAGGTCACTTGAGAAGAATGACACATGGGTGTTGACTGAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.945979
Expected error %
0.573435
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157O23
Clone
Clone name
hba-157o23
LE_HBa0157O23
C06HBa0157O23
P157O23
Clone type
BAC
Contamination
none
Estimated length
153,490
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found