Clone Read LE_HBa0157P07_T7_76381

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157P07_T7_76381
Primer
T7
ID from Seq. Facility
LE_HBa_157_P07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
755 trimmed for vector and quality, 820 raw
Genbank Accession
Sequence
>LE_HBa0157P07_T7_76381 (raw untrimmed)
CCCGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTATCCGGCCATGTTGTTTGCGTTTTAAATCGGAGCATAGCTGCCATGGG
ATAGTGTTGACCAGATTCTGACGCGAAGACTGCTCCAATACCTTTACCTTGATGATTTTCCGCTCTGTCAAAGAATAATCTCCAACATGGATATGCTTCA
GAAATATCCTCACCCACAAACGACACTTCTTCATCATAAAAAGAAGTTTTAAGTGGTTCATACTCTTCATCAACGGGATTTTCTACAAGATGATCAGCCA
AAGTCTGTGCCTTTATTGCCTTCTGAGTCACATACATGATATCAAACTCACTCAACAGCATTTGCCATTTAGCTAACTTTCCGGTCGGCATCGCTTTCTT
GAAAATATACTTCAATGGATCCATTCTAAAAATGAGATATGTAGTATACGAAGACAAATAGTATCTCAACTTCTAGGCAAGCCACGTCAAAGCACAACAT
GTTCTCTCCAACAAAGTGTAACGAGACTTGTATCGACTAAACTTCTTGCTTATATAATAGATAGCCCTTTCCTCTTTCCTGTCTCATCGTGTTGACCAAG
TACGCACCAAAATGCACTATCTGAGACAGACAAGTAGAACAACAAAGGACTCCTTTCTCGCGGAGGAACCAATACCGGTGGATTGGACAAATAATTCTTG
ATAGCATCAAAAGCAGTATGGAAATTCTTCAGTCCACTGTGTCGGGGCGTCCTTCTTCAACAAGCTTGAAAATAGGCTCACACACCACGGTTGGATTGGA
GCTATGAACACACTGGATGA
>LE_HBa0157P07_T7_76381 (trimmed for quality and cloning vector)
AGCTTCGTATCCGGCCATGTTGTTTGCGTTTTAAATCGGAGCATAGCTGCCATGGGATAGTGTTGACCAGATTCTGACGCGAAGACTGCTCCAATACCTT
TACCTTGATGATTTTCCGCTCTGTCAAAGAATAATCTCCAACATGGATATGCTTCAGAAATATCCTCACCCACAAACGACACTTCTTCATCATAAAAAGA
AGTTTTAAGTGGTTCATACTCTTCATCAACGGGATTTTCTACAAGATGATCAGCCAAAGTCTGTGCCTTTATTGCCTTCTGAGTCACATACATGATATCA
AACTCACTCAACAGCATTTGCCATTTAGCTAACTTTCCGGTCGGCATCGCTTTCTTGAAAATATACTTCAATGGATCCATTCTAAAAATGAGATATGTAG
TATACGAAGACAAATAGTATCTCAACTTCTAGGCAAGCCACGTCAAAGCACAACATGTTCTCTCCAACAAAGTGTAACGAGACTTGTATCGACTAAACTT
CTTGCTTATATAATAGATAGCCCTTTCCTCTTTCCTGTCTCATCGTGTTGACCAAGTACGCACCAAAATGCACTATCTGAGACAGACAAGTAGAACAACA
AAGGACTCCTTTCTCGCGGAGGAACCAATACCGGTGGATTGGACAAATAATTCTTGATAGCATCAAAAGCAGTATGGAAATTCTTCAGTCCACTGTGTCG
GGGCGTCCTTCTTCAACAAGCTTGAAAATAGGCTCACACACCACGGTTGGATTGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974083
Expected error %
0.86044
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 219 E Value 7e-72 Identity 64.10% Align. Length 637bp (84.37%) Frame 1
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 194 E Value 2e-48 Identity 49.80% Align. Length 638bp (84.50%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157P07
Clone
Clone name
hba-157p7
LE_HBa0157P07
P157P07
Clone type
BAC
Contamination
none
Estimated length
92,584
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found