Clone Read LE_HBa0157P11_T7_76389

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0157P11_T7_76389
Primer
T7
ID from Seq. Facility
LE_HBa_157_P11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
624 trimmed for vector and quality, 841 raw
Genbank Accession
Sequence
>LE_HBa0157P11_T7_76389 (raw untrimmed)
ACTCGGGACCGTGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACCCTGTGTGCTCGACGTAGTCACTTCAATTAGTCACTCAAGAATCTAAA
TTTCTCGTGATACATATAGTGTTTACCCTAACTGTCAGCTAATGCCAGCCTCTGTTTATGAGTATCAGTTGGTAACTTGACATCAGTGGCCAATCCAATA
GCTTGAAGAAATCGTACTACATACCAAGTCATGTCAAGTTGCCACCATTTTAATCCATGCCTGGCTGAATACTCAAACGCGTGGTGGTTGTTGTGCCAAC
CTTCTCCAAATGCAAGCAATGCCACCCACCTATATTATACAAAATTGAGTCCCCAAAAATGGACAAAAAGAAAAGAAGCAACAAGACAAATAAATTTTAA
AACTTTTATACTTACCAGTTGTTCCTTGATAAGTCACCAGTATTCCACGCCTGCTTTCCCCATACATGGCATGCTGAATTTACTAGCCAAGTTATGTGGT
ATACCCACACAATTCTCACCCCCTGCACACGCAGTGAGTTTAGCAGTTGAATTTTCAGAATCTCATTGCACCAAATGCATAGAACTCAGAATTTTGCCTA
TGTTACTATCGGATAATCACCCAAATACTAGTTTTAAGTTTGATTTCTGATAGCCATGCTGATCAATTTCCTTAAAAGTACTAGAATCTATTTCTTTTAC
CCTCGAATGACTTCACTATCATCAAAACATCAATCAATTGCCAGTGAACATCCAAAAGGACATGTTGTATTGTAACATCAATCATATTAACACTTTGATT
TTTCCAATAAGTATTTTTAAAAAAGAAAAAATACCCATAAA
>LE_HBa0157P11_T7_76389 (trimmed for quality and cloning vector)
AGCTTCACCCTGTGTGCTCGACGTAGTCACTTCAATTAGTCACTCAAGAATCTAAATTTCTCGTGATACATATAGTGTTTACCCTAACTGTCAGCTAATG
CCAGCCTCTGTTTATGAGTATCAGTTGGTAACTTGACATCAGTGGCCAATCCAATAGCTTGAAGAAATCGTACTACATACCAAGTCATGTCAAGTTGCCA
CCATTTTAATCCATGCCTGGCTGAATACTCAAACGCGTGGTGGTTGTTGTGCCAACCTTCTCCAAATGCAAGCAATGCCACCCACCTATATTATACAAAA
TTGAGTCCCCAAAAATGGACAAAAAGAAAAGAAGCAACAAGACAAATAAATTTTAAAACTTTTATACTTACCAGTTGTTCCTTGATAAGTCACCAGTATT
CCACGCCTGCTTTCCCCATACATGGCATGCTGAATTTACTAGCCAAGTTATGTGGTATACCCACACAATTCTCACCCCCTGCACACGCAGTGAGTTTAGC
AGTTGAATTTTCAGAATCTCATTGCACCAAATGCATAGAACTCAGAATTTTGCCTATGTTACTATCGGATAATCACCCAAATACTAGTTTTAAGTTTGAT
TTCTGATAGCCATGCTGATCAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963468
Expected error %
0.44852
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g15850.1 Score 125 E Value 5e-49 Identity 85.50% Align. Length 379bp (60.74%) Frame 1
68416.m02005 fatty acid desaturase family protein similar to delta 9 acyl-lipid desaturase (ADS1) GI:2970034 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g15870.1 Score 110 E Value 6e-36 Identity 73.00% Align. Length 382bp (61.22%) Frame 1
68416.m02007 fatty acid desaturase family protein similar to delta 9 acyl-lipid desaturase (ADS1) GI:2970034 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN41357.1| Score 125 E Value 2e-47 Identity 85.50% Align. Length 379bp (60.74%) Frame 1
putative delta 9 desaturase [Arabidopsis thaliana] dbj|BAB02316.1| delta 9 desaturase-like protein [Arabidopsis thaliana] sp|Q949X0|ADS3_ARATH Palmitoyl-monogalactosyldiacylglycerol delta-7 desaturase, chloroplast precursor (Monogalactosyldiacylglycerol-specific palmitic acid desaturase) (Delta 7 desaturase) (FAD5) ref|NP_566529.1| fatty acid desaturase family protein [Arabidopsis thaliana] dbj|BAD23903.1| monogalactosyldiacylglycerol-specific palmitic acid desaturase [Arabidopsis thaliana] gb|AAW51920.1| palmitoyl-monogalactosyldiacylglycerol delta7-desaturase [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM63459.1| Score 125 E Value 2e-47 Identity 85.50% Align. Length 379bp (60.74%) Frame 1
putative delta 9 desaturase [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0157P11
Clone
Clone name
hba-157p11
LE_HBa0157P11
C03HBa0157P11
P157P11
Clone type
BAC
Contamination
none
Estimated length
124,715
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found