Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0160K24_SP6_76942

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0160K24_SP6_76942
Primer
SP6
ID from Seq. Facility
LE_HBa_160_K24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
666 trimmed for vector and quality, 893 raw
Sequence
>LE_HBa0160K24_SP6_76942 (raw untrimmed)
GGGGGCCGGCTTTTCCTTTCTTTACACATGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTCCTTTAGATGTGCCGCCCAAGCGA
AACTCCCCACCTGACAATGTCTTCTGCACGGATCGGCCCGCGAAGTGAGCCTTTGGTCCAAAAAGAGGGGCAGTGCCCCACTTCCGATTCACGGAATAAG
TAAAATAACGTTTAAAGTAGTGGTATTTCACTTTCGCCTTTCGACTCCCACTTATATTACACCTCTCAAGTCATTTGATAAAGTCGGACTAGAGTCAAGC
TCAACAGGGTCTTCTTTCCCCGCTGATTCTTCTAAGCCCGTTCGCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGGAATCTCGTTAATCCA
TTCATGCACGTCACTAATTAGATTACGAGGCATTTGGCTACCTTAAGAGAGTCATAGTTACTCCTGCCGTTTACCCGCGCTTGGTTGAATTTCTTCACTT
TGACATTCAGAGCACTGTGCAGAAATCACATTGCGTAAACATCCGTTGCGACCATCGCAATGCTTTGTTTAAATTAAACAGTCGGATTCCCCTTGTCCGT
ACAAGTTCTGAGTTGTTTGTTCGACACCCGAAGAAGGCCCCCGAAGGAACCGTTCCTAGTCCTTCCCCCCGTCCGGCACGCGGCAACACGCTCTCGCCGT
GGGAAGCACTCGAGCAGTCCACCGAACAGCCCGACGGGTTTGGGATTGGATCCCGTGGAACGCCCTTCAGCCAAATCCTTTCCCAAAATAACGATCAATA
TGCAAACTTCTCTGTGCTAATTTGTCAAACAACAAAAGTTTTTACCTGGAAAACAGAGTAGGTAGAAGATATTTGGTAAGGAGGAATTTGGTC
>LE_HBa0160K24_SP6_76942 (trimmed for quality and cloning vector)
TGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTCCTTTAGATGTGCCGCCCAAGCGAAACTCCCCACCTGACAATGTCTTCTGCA
CGGATCGGCCCGCGAAGTGAGCCTTTGGTCCAAAAAGAGGGGCAGTGCCCCACTTCCGATTCACGGAATAAGTAAAATAACGTTTAAAGTAGTGGTATTT
CACTTTCGCCTTTCGACTCCCACTTATATTACACCTCTCAAGTCATTTGATAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATT
CTTCTAAGCCCGTTCGCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGGAATCTCGTTAATCCATTCATGCACGTCACTAATTAGATTACGA
GGCATTTGGCTACCTTAAGAGAGTCATAGTTACTCCTGCCGTTTACCCGCGCTTGGTTGAATTTCTTCACTTTGACATTCAGAGCACTGTGCAGAAATCA
CATTGCGTAAACATCCGTTGCGACCATCGCAATGCTTTGTTTAAATTAAACAGTCGGATTCCCCTTGTCCGTACAAGTTCTGAGTTGTTTGTTCGACACC
CGAAGAAGGCCCCCGAAGGAACCGTTCCTAGTCCTTCCCCCCGTCCGGCACGCGGCAACACGCTCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.984108
Expected error %
0.209852
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02995 Score 227 E Value 2e-58 Identity 24.80% Align. Length 527bp (79.13%) Frame 1
unspecific monooxygenase (EC 1.14.14.1) - common tobacco dbj|BAA10929.1| cytochrome P450 like_TBP [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02955 Score 198 E Value 1e-49 Identity 22.60% Align. Length 539bp (80.93%) Frame 1
probable cytochrome P450 monooxygenase - maize (fragment)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0160K24
Clone
Clone name
hba-160k24
LE_HBa0160K24
C02HBa0160K24
P160K24
Clone type
BAC
Contamination
none
Estimated length
180,208
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found