Clone Read LE_HBa0164B09_SP6_77248

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164B09_SP6_77248
Primer
SP6
ID from Seq. Facility
LE_HBa_164_B09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
317 trimmed for vector and quality, 693 raw
Genbank Accession
Sequence
>LE_HBa0164B09_SP6_77248 (raw untrimmed)
TTTATAATTTCTATTATGATTATTTATGATTTCGCTAGAAAGATGGAGTGGTAATAGAGTACCTTCCTTTTTTATTTCCAAATGTAGTGGGCTTTTTAGA
AGGACATGTGCTAAGGAGTCATTTTCTGTTGGTACTAAATGAAATGATTTTGTCTGTGACATGTGATAAGGAGTCATTTTCTGTTGGTACAAAATGAAAT
GATTTTGTCTGCTGAGTTTTGTAGTGTTCATGTACCATTAAATGGTAGGTCAAATTTACTGTTTTACTTTCTTGAGTGCTCAATTTGTTTGTCCTTTTGT
CTTGCCAATTGCTCATTCACCTTGCATTAGCATTCCCGCCCCTAAAGAGATTTTGGAAATTGAATTTTATTAGTAGTGATAAATAAGCTCCCCCTCCCCA
CTAGTACTTATTGTCTATTGGTATCACTTTCTTATTTTATGTTGTGGTTTATACTCCTCATTATCTGTTTGACTATTTCCCTGAGATATTAGTTCATAAT
TGTTTCTGATATTCTTTCTTTTTTTTCTTATTTTATTTTCCCCTTTCTATCCCTCCCTTTGCCCCTTCGTCTTTTTTTTTTTATTTTTATCTTCTTTTCT
TTACTTTTTCTCTTCTTCTTTTCTTTTCATTTCCTTTCTCTCTATTATCTTATTTCCTCATCTATACATTACATCTCTCTTTACTTCTCTCTT
>LE_HBa0164B09_SP6_77248 (trimmed for quality and cloning vector)
AAGATGGAGTGGTAATAGAGTACCTTCCTTTTTTATTTCCAAATGTAGTGGGCTTTTTAGAAGGACATGTGCTAAGGAGTCATTTTCTGTTGGTACTAAA
TGAAATGATTTTGTCTGTGACATGTGATAAGGAGTCATTTTCTGTTGGTACAAAATGAAATGATTTTGTCTGCTGAGTTTTGTAGTGTTCATGTACCATT
AAATGGTAGGTCAAATTTACTGTTTTACTTTCTTGAGTGCTCAATTTGTTTGTCCTTTTGTCTTGCCAATTGCTCATTCACCTTGCATTAGCATTCCCGC
CCCTAAAGAGATTTTGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.930342
Expected error %
0.442263
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164B09
Clone
Clone name
hba-164b9
LE_HBa0164B09
P164B09
Clone type
BAC
Contamination
none
Estimated length
62,348
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found