Clone Read LE_HBa0164B09_T7_77249

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164B09_T7_77249
Primer
T7
ID from Seq. Facility
LE_HBa_164_B09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
476 trimmed for vector and quality, 891 raw
Genbank Accession
Sequence
>LE_HBa0164B09_T7_77249 (raw untrimmed)
CCAAAACTCGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCCAAACATACAGGGTATAGCATATCTACAACTTGTCAAAAGTGA
TTTGGTTTCCTAGTTCAACAGCAAAAGTCAGGGTCAGAAATCATTTTTAAAGTAGTCATCTTTTTTCATGTACACGTGGAGGTGTTTTTCACCATGAAAT
GTGTCAGTAGTCATGTGTTGATGATGTGGTGAGTCAGCTTTATCCATTGTGTTCAAATTTCAGCGTCAGCATTGTACTTATGCCATGTCATCAGACACTT
TCCTCTCGACTTGTGGTGAGCAGGATATGGTTCTACCAGTGATTCCTATGGTTAATTGATTTTCCTTTTTTTCAGCCTCATTAATTTTGTTGCATCAACT
TTCTTTTAATGACAATAGGCTAGAATAAACGTGATAACATAAGAAGTAAGTTGGAGTAGGTACAATTTGAGATGTGAATCTTATCATAATAGGATAATAT
AAGCTCTATTGAAGTTGACCCTTGAAATCCCAGCTTAAAATTTTGTCGGCTAGAACTAACATCACTTCTAAATGCTTTTCGGGCAATTTATTCACTTTCT
TTCATCTTTCTCCTTAATTATGTATCGAACAATTATACTTTCAATCAACTAAAATAATTTTTATATAATAACATAGCCACCCTCTTATATTTTACATTAA
ATTTATTCGATCTTAATGGATATAGTTTGACTAGAATGTTCTGTAACTTTTTATATATTATTATTCATTTTGTTAAAAATATAAATTTATTTTCTCTTCT
ATCTTCAGTTGGATTTCTATACTCCGTCTATCTTACCTACTTTTTTCTCGATTTATATTTCTCTTTGTCTTTTTTCCTTTTTCTATCTTTN
>LE_HBa0164B09_T7_77249 (trimmed for quality and cloning vector)
AGCTTATCCAAACATACAGGGTATAGCATATCTACAACTTGTCAAAAGTGATTTGGTTTCCTAGTTCAACAGCAAAAGTCAGGGTCAGAAATCATTTTTA
AAGTAGTCATCTTTTTTCATGTACACGTGGAGGTGTTTTTCACCATGAAATGTGTCAGTAGTCATGTGTTGATGATGTGGTGAGTCAGCTTTATCCATTG
TGTTCAAATTTCAGCGTCAGCATTGTACTTATGCCATGTCATCAGACACTTTCCTCTCGACTTGTGGTGAGCAGGATATGGTTCTACCAGTGATTCCTAT
GGTTAATTGATTTTCCTTTTTTTCAGCCTCATTAATTTTGTTGCATCAACTTTCTTTTAATGACAATAGGCTAGAATAAACGTGATAACATAAGAAGTAA
GTTGGAGTAGGTACAATTTGAGATGTGAATCTTATCATAATAGGATAATATAAGCTCTATTGAAGTTGACCCTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944877
Expected error %
1.13705
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164B09
Clone
Clone name
hba-164b9
LE_HBa0164B09
P164B09
Clone type
BAC
Contamination
none
Estimated length
62,348
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found