Clone Read LE_HBa0164F08_SP6_77438

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164F08_SP6_77438
Primer
SP6
ID from Seq. Facility
LE_HBa_164_F08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
200 trimmed for vector and quality, 886 raw
Genbank Accession
Sequence
>LE_HBa0164F08_SP6_77438 (raw untrimmed)
TTTCGAGCTACATGGAAAGATAGGATAACGTGGAGAAACACGTTCGCTATGCAGTCCACTCACAACCTAGCCAAAGATGAGATTCGTGAAGAAATGGCTC
AGATAAGAACTGAGCTTGGGTTGGTGCTAAAACATGTCACAGGGAGTGCAGAAAAGATAAATGCAGTAAACTACTTGTCTAAACAACCACCTCCTAATGA
TGAATGTTATTATGCAGAGGACTCCTGCGGTAAATGAGAAGACGGGGGGTTTCCGACCTAGCTCCCAATCCTTATATATATGATTATTGGCGCCAAGGTT
AAGGGAACCAAGGTCAAATCTATGGTAACTTCATTTTTTTTTTTTCANNCCTGNAAGAAGGAAACTACAACTGCGACAATAACTTTAATAAGGGGTAACT
ACGGTAATAGAAATTATAGGAATGGGCCCAATGTCTCCTCCTCAGAATCTTTAAGTTACTTCCTTGGAATGGTGGAGATATTATGGCGTGTAGTTGAGGC
TTTGTTGCACGACCCCCCCCTCTATGAATGATGTTATTGATTATTATATTATACATTTATTTTATTTTTTTATTTTTTTTGTGTTCTTATTTGACTTTTT
TCTTTTTACATTTATCTTTTTTTATCTATCTTTCCTCTGGTGACTTTTAGCTTTGCATTGTGTAATCGATCTATTTATTGTTATCTTTTTAACTCTCTTT
GTTTTTATATTCAATATCTCCTCTTTTTTTCTTTCTTTTTTTATAACCCTTTGGGGTGTAATATTTAATTATTTTTTATTATTTTATTATATTTATTCAA
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGCCCCCCCCATCATTTTTTTTTTTTTTTTTTTTTTTTTTTT
>LE_HBa0164F08_SP6_77438 (trimmed for quality and cloning vector)
CACTCACAACCTAGCCAAAGATGAGATTCGTGAAGAAATGGCTCAGATAAGAACTGAGCTTGGGTTGGTGCTAAAACATGTCACAGGGAGTGCAGAAAAG
ATAAATGCAGTAAACTACTTGTCTAAACAACCACCTCCTAATGATGAATGTTATTATGCAGAGGACTCCTGCGGTAAATGAGAAGACGGGGGGTTTCCGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951321
Expected error %
0.62118
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 82 E Value 4e-15 Identity 22.80% Align. Length 161bp (80.50%) Frame 3
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164F08
Clone
Clone name
hba-164f8
LE_HBa0164F08
P164F08
Clone type
BAC
Contamination
none
Estimated length
103,316
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found