Clone Read LE_HBa0164F08_T7_77439

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164F08_T7_77439
Primer
T7
ID from Seq. Facility
LE_HBa_164_F08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
512 trimmed for vector and quality, 925 raw
Genbank Accession
Sequence
>LE_HBa0164F08_T7_77439 (raw untrimmed)
GGAGGGTGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGCTATCATTCATTACATAAGACTTGAAAAGTAGTGTTGTATTAAA
ACTTTTCATGAATAAATTAATCAAGCAAACATCTTTCATAAAATCTAAAGGATTTGATCTCGTATACACAAGCTAACTTAAAGACAAGATATAAATATCT
TAGGGACATAACCCTTTACAATAAATGAAAAATATATAATAAGTCTTTTGAATAGAAACTAAGAAATACGACCATGCCTCGAATAAATGAGGACATCATT
TGTCTTGAGAGAATTTTTCCCAAACTTGTCTTCTATTCTTCAAAATCCTCCAACCTATACTTATTTATTATAAAAAAGTATGGGGTTTGTCACATCCTGA
AAACCCCTAAGAAGAACTAAGGTTAACTACAACATCGTGATTGTTTATTGAGTTAATTTTGTGTTAAAATGAGTTACATTAGTATTCTTAGGCAGTGTGT
GAAGTTTTGTGAAGTGTTGTTAAGTTTTTAGGGCAAACAACCAAGAATATCCACAATATTCCAAGCGGTGTGTCTTATATAGAGCTTTAGGTCTTGATGT
GTATGAAGTGTGTTATAGATGTTATATTTATCAAATATAGGATTAGATGAAACTAATATGTATGTACGAGCGAATAACGGCTGGTTGACTATGGATAACT
GCTACATTTTATCTAGAACTTGTCCATATAAAAGTAGTGAACAATAGACGGTAGACTATATCATGTAAAAGAATATATAACTATTAAAATTAAAATAAGT
GTATGAAATCAACCATCGGATAGCGCTAATAGCGTTTATTGTAATTCGCTTAGAACAATAGATACATATTAACAATCAATTCGATGAATATCATGTTCGA
AGACTGAGACCTAGACGTAATAACC
>LE_HBa0164F08_T7_77439 (trimmed for quality and cloning vector)
AGCTTTAGCTATCATTCATTACATAAGACTTGAAAAGTAGTGTTGTATTAAAACTTTTCATGAATAAATTAATCAAGCAAACATCTTTCATAAAATCTAA
AGGATTTGATCTCGTATACACAAGCTAACTTAAAGACAAGATATAAATATCTTAGGGACATAACCCTTTACAATAAATGAAAAATATATAATAAGTCTTT
TGAATAGAAACTAAGAAATACGACCATGCCTCGAATAAATGAGGACATCATTTGTCTTGAGAGAATTTTTCCCAAACTTGTCTTCTATTCTTCAAAATCC
TCCAACCTATACTTATTTATTATAAAAAAGTATGGGGTTTGTCACATCCTGAAAACCCCTAAGAAGAACTAAGGTTAACTACAACATCGTGATTGTTTAT
TGAGTTAATTTTGTGTTAAAATGAGTTACATTAGTATTCTTAGGCAGTGTGTGAAGTTTTGTGAAGTGTTGTTAAGTTTTTAGGGCAAACAACCAAGAAT
ATCCACAATATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.921455
Expected error %
0.442605
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164F08
Clone
Clone name
hba-164f8
LE_HBa0164F08
P164F08
Clone type
BAC
Contamination
none
Estimated length
103,316
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found