Clone Read LE_HBa0164H04_SP6_77526

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164H04_SP6_77526
Primer
SP6
ID from Seq. Facility
LE_HBa_164_H04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
570 trimmed for vector and quality, 803 raw
Genbank Accession
Sequence
>LE_HBa0164H04_SP6_77526 (raw untrimmed)
GTACGGACGATTTGACAGGGGGAGTGAGCAGATTACAGGGTGCAAATAAGAATATTGTGTCTAAGATTGACCTTAAACAGAAAGATATGCAATTTGTGCG
GCACAGAACAATCTTTTGAGGGCACAAGCAATGGAATTGACTGATAGGCTCAGGTATTTAAATGATGTTATTGACAGTACTGGTTTGGCTGCTGATGTTG
CTGATCCTTTGTTGAAGCCATTGCAGAATCCTTGTGCAATGCAGCCTATTGCTTCATCAGGATTGTTTAAATTTTAATCGTTGTAATGGCTTGTTTGGAT
AGCGTTGCTTCCATTATTCTATATTCTCGTCCTTTCCTTGGATGGTAATGTCATGTTAGTTATGCCTTTGTTGGTTATGTTTTAGTGTCTGCTTACTCTT
TTTTAACCATGTAAATACCAAGAATTAGCTTGGAGTTGTTGAATCGGATGTTTGTATCTTACCGACTGGTCTTTGTTTACGATCATACCCACAATGAGGG
ATAATTGATTTGTCATATCATCTCTGTTATTGAGAATTCAGGTTATGATCCTAGTGAAAGCTATCGTGAATTGACTAGTTTTACATTGGTCACAACGTCC
TCCTTTATCCATTATTAATAATGTCAACTGTTTGGATTTTGAAGAGCAGTAGTAGCTTGTCATGTTTTACTATTATATTTTTTTTGATTTGATTCTGATG
TGTCATGTCATGGCTGATATTGAGAATTCAGGTAAGGATCTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTCCCCCCCCCTTTTTTTTTTTTTTTTTT
TTT
>LE_HBa0164H04_SP6_77526 (trimmed for quality and cloning vector)
GTGAGCAGATTACAGGGTGCAAATAAGAATATTGTGTCTAAGATTGACCTTAAACAGAAAGATATGCAATTTGTGCGGCACAGAACAATCTTTTGAGGGC
ACAAGCAATGGAATTGACTGATAGGCTCAGGTATTTAAATGATGTTATTGACAGTACTGGTTTGGCTGCTGATGTTGCTGATCCTTTGTTGAAGCCATTG
CAGAATCCTTGTGCAATGCAGCCTATTGCTTCATCAGGATTGTTTAAATTTTAATCGTTGTAATGGCTTGTTTGGATAGCGTTGCTTCCATTATTCTATA
TTCTCGTCCTTTCCTTGGATGGTAATGTCATGTTAGTTATGCCTTTGTTGGTTATGTTTTAGTGTCTGCTTACTCTTTTTTAACCATGTAAATACCAAGA
ATTAGCTTGGAGTTGTTGAATCGGATGTTTGTATCTTACCGACTGGTCTTTGTTTACGATCATACCCACAATGAGGGATAATTGATTTGTCATATCATCT
CTGTTATTGAGAATTCAGGTTATGATCCTAGTGAAAGCTATCGTGAATTGACTAGTTTTACATTGGTCAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948371
Expected error %
0.790113
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAG29393.1| Score 132 E Value 8e-34 Identity 98.50% Align. Length 250bp (43.86%) Frame 2
anaerobic basic leucine zipper protein [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK92215.1| Score 107 E Value 4e-24 Identity 78.80% Align. Length 250bp (43.86%) Frame 2
bZIP transcription factor BZI-4 [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164H04
Clone
Clone name
hba-164h4
LE_HBa0164H04
P164H04
Clone type
BAC
Contamination
none
Estimated length
96,554
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found