Clone Read LE_HBa0164M15_SP6_77788

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164M15_SP6_77788
Primer
SP6
ID from Seq. Facility
LE_HBa_164_M15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
382 trimmed for vector and quality, 789 raw
Genbank Accession
Sequence
>LE_HBa0164M15_SP6_77788 (raw untrimmed)
TTATTAAAATTTAATCCTAGAAAAATTGCATTTGGAACTCTAATTGTGACTAAACTTCAACATGGACAAAAGCTTTTGGTAAATTTATCATCCATTTTGG
TCCTGTTGCAGTTTTCCATTTGGTCGAGCAGTAGGACAACTTCTTTGTTCATAATCCCTTGTCCGTCATCCTTTATTCAAGAATAACTAATGCTGCAGTT
CCTTCACTTTTCAGTAGAAGTCTGATGTACTGTTCAAATATCTTGCAAATGTAATGTTGAAGGACTATTTGTAGGTATTTAACATGTCGGGTGTCAACTT
GGATGCTGATCAGAGATTAAATCAAGATCTGGAGAAGCTAACCGCTGACTTGTCTAGTCTGGTAACTGGAATGGTGAAGCCAACTGTTGACATTCTATGG
TAAGTTTCTTTTGTGGCTGTCAAGCTAATGTTTAAACAGTATGATTTCTGGTTTTTTAGAGTGACTACTGAAATGCATGTTCACATGGAGAATGAAAATG
CTAACTGGCCAGAGGGGTCTCGCTATATTTTATGCTTACACGCTATCAGGTTATTGTTATTTTTTATTTTTTTTTCTTTATTTTCTTTAATTAGTCTATT
AAAGGTTTTTTTTTTTTTAATTATTATGATGTTTAGAGTGTATTTTATTATTATGTTTATTGTTTTTTTGTAGATTGAGTTTATTTAAGTTTAGAAATTT
TGTTTTTTATGTTTTTTTTTTTAAGGTTTTTTTATTTTGTTTTTATTGTGTTTTTTTTATGTTTTGTGTTGTTTTTTTTTTATTTTTTG
>LE_HBa0164M15_SP6_77788 (trimmed for quality and cloning vector)
GACTAAACTTCAACATGGACAAAAGCTTTTGGTAAATTTATCATCCATTTTGGTCCTGTTGCAGTTTTCCATTTGGTCGAGCAGTAGGACAACTTCTTTG
TTCATAATCCCTTGTCCGTCATCCTTTATTCAAGAATAACTAATGCTGCAGTTCCTTCACTTTTCAGTAGAAGTCTGATGTACTGTTCAAATATCTTGCA
AATGTAATGTTGAAGGACTATTTGTAGGTATTTAACATGTCGGGTGTCAACTTGGATGCTGATCAGAGATTAAATCAAGATCTGGAGAAGCTAACCGCTG
ACTTGTCTAGTCTGGTAACTGGAATGGTGAAGCCAACTGTTGACATTCTATGGTAAGTTTCTTTTGTGGCTGTCAAGCTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960244
Expected error %
0.251393
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g39850.1 Score 70 E Value 2e-13 Identity 26.20% Align. Length 125bp (32.72%) Frame 1
68417.m05646 peroxisomal ABC transporter (PXA1) identical to peroxisomal ABC transporter PXA1 GI:15320529 from [Arabidopsis thaliana]; contains Pfam profile PF00005: ABC transporter;
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80648.1| Score 73 E Value 2e-12 Identity 23.80% Align. Length 146bp (38.22%) Frame 1
putative protein [Arabidopsis thaliana] emb|CAB38898.1| putative protein [Arabidopsis thaliana] pir||T06091 hypothetical protein T5J17.20 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC85290.1| Score 70 E Value 1e-11 Identity 26.20% Align. Length 125bp (32.72%) Frame 1
ABC transporter [Arabidopsis thaliana] ref|NP_568072.1| peroxisomal ABC transporter (PXA1) [Arabidopsis thaliana] gb|AAK95343.1| peroxisomal ABC transporter PXA1 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164M15
Clone
Clone name
hba-164m15
LE_HBa0164M15
P164M15
Clone type
BAC
Contamination
none
Estimated length
109,016
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found