Clone Read LE_HBa0164M15_T7_77789

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0164M15_T7_77789
Primer
T7
ID from Seq. Facility
LE_HBa_164_M15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
425 trimmed for vector and quality, 902 raw
Genbank Accession
Sequence
>LE_HBa0164M15_T7_77789 (raw untrimmed)
GCAAACCTGGGCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACTTCCTGCAGGTTGTTGTCCCTATTTTAAAACATCAATCATTTCT
CTCTCTCCATATAGTCCACCATATACAAGCAGGTATCATCCTCCATCTTTCTCTGTTTGTAGCCCCAACTCCAACCTCCTCCCAACTGAAAAGAGTCTCA
TCAACCTTACTAGGCATAGTCCAGGAAATGCCTCTGAGATTAAGGAAAATCTGGCACAGTTGATCAGTGAAATTGCAGTGTAGAAAGAGGTGTTTCACTG
TCTCTGTATCCTTACAACAGAAGGAGCATCTGTTGCATAGAGATATACCTCTCTTGGCCACATTGTTCAATGTCAGAACTGCTTCATTGGCTAGCAGCCA
GGTGAAGCATGCCATTATTTGTGGCACCTCGACTCTCCAAATTTGCTTCCCAAGGCCATTTGAAGACTTATAAGGAGTGTGGGTTACTCAGATTTGGAAC
CAGTTTTACTTATTTCATTCTTTCCTTCTTTACTTTGATTAGTAATCTGACAGATTATTCAAAGCACCTTTCACAAATTGTCTCCTTAATTCTATCCTAG
ACCCCAACCTGTACCACGAAACCCCACACATTCCATTATATGCATTACAGATACTTATTCAGAAAATCTTAAAGGAATCATAACACTTTATCCCTTCATT
CTATTTATTTTCTATTTACTCATTGATTTATGCACTTCGTGTATAATAATGTCTCTTTCTTATATTGAATAATTCCTCCGTTTCCTCGTATAGATCCTCA
CTTATATATATCATTCACCTATCTTATAACATCCTATCTCTTCTATATCTTACCCTTCTGACCACTCACAACTTCCCCCTTATCTCCCCCTCTCTCCCAC
TC
>LE_HBa0164M15_T7_77789 (trimmed for quality and cloning vector)
AGCTTGACTTCCTGCAGGTTGTTGTCCCTATTTTAAAACATCAATCATTTCTCTCTCTCCATATAGTCCACCATATACAAGCAGGTATCATCCTCCATCT
TTCTCTGTTTGTAGCCCCAACTCCAACCTCCTCCCAACTGAAAAGAGTCTCATCAACCTTACTAGGCATAGTCCAGGAAATGCCTCTGAGATTAAGGAAA
ATCTGGCACAGTTGATCAGTGAAATTGCAGTGTAGAAAGAGGTGTTTCACTGTCTCTGTATCCTTACAACAGAAGGAGCATCTGTTGCATAGAGATATAC
CTCTCTTGGCCACATTGTTCAATGTCAGAACTGCTTCATTGGCTAGCAGCCAGGTGAAGCATGCCATTATTTGTGGCACCTCGACTCTCCAAATTTGCTT
CCCAAGGCCATTTGAAGACTTATAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954397
Expected error %
1.09884
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_479426.1| Score 68 E Value 7e-11 Identity 9.60% Align. Length 374bp (88.00%) Frame 3
cyst nematode resistance protein-like protein [Oryza sativa (japonica cultivar-group)] dbj|BAD31431.1| cyst nematode resistance protein-like protein [Oryza sativa (japonica cultivar-group)] dbj|BAC10089.1| cyst nematode resistance protein-like protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0164M15
Clone
Clone name
hba-164m15
LE_HBa0164M15
P164M15
Clone type
BAC
Contamination
none
Estimated length
109,016
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found