Clone Read LE_HBa0034K06_SP6_7786

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0034K06_SP6_7786
Primer
SP6
ID from Seq. Facility
LE_HBa_034_K06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
748 trimmed for vector and quality, 842 raw
Genbank Accession
Sequence
>LE_HBa0034K06_SP6_7786 (raw untrimmed)
AAATTAGGGGCCCCGTNTNGAAGCTTAGCTTNGATNGGGACGTGTACCACTTTTCACAACAAGATGATGGACTGCCACCTTCGGGTCTAATCCAAGCATT
GCTTTGTAACTCCAGGAAAATACATCTTTATACTCTTTGAGTAAGTCAACATAGTCTCTTTCCTCATCACTTGCCAATGAAGCATTCACATAAATGGGTT
TTGGATCTTCATTAGTTCAAAGGCTGATTTCTTTCAATGTATCAATTGTACCATTTACTCTTTTTTCAAGTTCGGGTGGCGCACCTTTAGCATCTTTATC
TTCTTGAGGTTCTCCATTATTGAAAAATATATGGCAATGCCATGAAACATTCTCCAACTCTCCATCCGTTTTAATTAGAGAAATAATATGCCTTTCATCT
TGTGCAATGACATGATATGAAGAGCCAACATTTTCTTCATCTTCATCACGATGCTTGGTGTAGACTATAACATTTGACTTTGCCTTTATTACTTCTCCAC
ATGAGACCACAATATTCGTTTGTTGCCTCATTCTAGAAGAGATCAGGTTTTGAAAGTCTTTAGGAGCACTTTGAGATTTGGGTAAAGAAGATGCCTGCAT
ACTCTTGGTATTCTCCAAACCTTGTTTTTCTTCTTCAATGGACCTAACCTCTCAAATACAGAGATCCACTTCATTGAGCTTCCAAGTCATTCGAAGAGAG
AAGATCTTTTGTTAGAGTTAGCGGACTCATCTTCCACAGTTATGTAGTTATTGCTTGTTTTGTTGTAGCCCAATTCTTCATGTGATTGCCTCATAACAGG
TTCTAATGGGAGTTTCCTTATTTTGGACGGTTCACTAAGATC
>LE_HBa0034K06_SP6_7786 (trimmed for quality and cloning vector)
GACGTGTACCACTTTTCACAACAAGATGATGGACTGCCACCTTCGGGTCTAATCCAAGCATTGCTTTGTAACTCCAGGAAAATACATCTTTATACTCTTT
GAGTAAGTCAACATAGTCTCTTTCCTCATCACTTGCCAATGAAGCATTCACATAAATGGGTTTTGGATCTTCATTAGTTCAAAGGCTGATTTCTTTCAAT
GTATCAATTGTACCATTTACTCTTTTTTCAAGTTCGGGTGGCGCACCTTTAGCATCTTTATCTTCTTGAGGTTCTCCATTATTGAAAAATATATGGCAAT
GCCATGAAACATTCTCCAACTCTCCATCCGTTTTAATTAGAGAAATAATATGCCTTTCATCTTGTGCAATGACATGATATGAAGAGCCAACATTTTCTTC
ATCTTCATCACGATGCTTGGTGTAGACTATAACATTTGACTTTGCCTTTATTACTTCTCCACATGAGACCACAATATTCGTTTGTTGCCTCATTCTAGAA
GAGATCAGGTTTTGAAAGTCTTTAGGAGCACTTTGAGATTTGGGTAAAGAAGATGCCTGCATACTCTTGGTATTCTCCAAACCTTGTTTTTCTTCTTCAA
TGGACCTAACCTCTCAAATACAGAGATCCACTTCATTGAGCTTCCAAGTCATTCGAAGAGAGAAGATCTTTTGTTAGAGTTAGCGGACTCATCTTCCACA
GTTATGTAGTTATTGCTTGTTTTGTTGTAGCCCAATTCTTCATGTGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953527
Expected error %
0.119067
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD41628.3| Score 87 E Value 3e-16 Identity 15.90% Align. Length 257bp (34.36%) Frame 3
OSJNBa0091D06.8 [Oryza sativa (japonica cultivar-group)] ref|XP_473330.1| OSJNBa0091D06.8 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_462905.1| Score 79 E Value 2e-13 Identity 16.00% Align. Length 218bp (29.14%) Frame 3
putative gag-pol precursor [Oryza sativa (japonica cultivar-group)] gb|AAK92670.1| putative gag-pol precursor [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0034K06
Clone
Clone name
hba-34k6
LE_HBa0034K06
P034K06
Clone type
BAC
Contamination
none
Estimated length
98,296
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found