Clone Read LE_HBa0034K10_SP6_7794

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0034K10_SP6_7794
Primer
SP6
ID from Seq. Facility
LE_HBa_034_K10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
646 trimmed for vector and quality, 830 raw
Genbank Accession
Sequence
>LE_HBa0034K10_SP6_7794 (raw untrimmed)
AAATTAACAATTTTTTCTGCTGCTGCTCCTCCATATAGTCCACCATATACAAGCAGGTATTATCCTCCATCTTTTTCTGTTGGTAGCCTCAACTCCAGCC
TCCTCCAACAGAAAAGAGTCTCATCAATCTTACTAGGCATACTCCAGGAAATGCCTCTTAGATTAAGAAAAATCTGCCACAGTTGAACAGTGAAATTGCA
GTGTAGAAAGAAGTGTTTTACTGTCTCTGTATCCTTACCACATAAGGAGCATCTGTTGCATAAAGATATACCGCTCTTGGCCACATTGTCCAATGTCAAA
ACTGCTTCATTGGCTAGCAGCCAGGTGAAGCATGCCACTTTTTGTGGCACTTTGACTCTCCAAATTTGCTTCCAAGGCCATCTGAAATCTTGATTCTCCA
TAAGACTGGTTTGTTTATATCCCTCATTCACCCTGTTTCTTCCTTTGTTGTGCCAATGCCACCATAAATAGTCTTCACCTGGTTGGATTCCTTGGAAACT
CTCCAGTAGTTTGAAAAGTTCAATCATTCTGGGAATTTCCCAGTCATTCAAGTTTCTTCTAAAGATCATATTCCATCCTTGTGGTGACCACATTTCAGCA
ACAGTTATGTTGAGCCAAAACAAAGATGTCAGGAAAGAGATCTTTAAAGCTCACAGTACCCACCTATTTATCAATCCAAAAACTTGTTTTTCTCCCATTT
CGAACTTTGACAGTTAATTGAATACTGGGAAACTGCCAGAATTTTCTAATGAATTTTCCGAGGGCTTATACCCTGGGGGGGGGTTGACCTCTTTGGGGTT
AACCCATGTGTTCCAGTTCCCCCATCTTTG
>LE_HBa0034K10_SP6_7794 (trimmed for quality and cloning vector)
CCATATAGTCCACCATATACAAGCAGGTATTATCCTCCATCTTTTTCTGTTGGTAGCCTCAACTCCAGCCTCCTCCAACAGAAAAGAGTCTCATCAATCT
TACTAGGCATACTCCAGGAAATGCCTCTTAGATTAAGAAAAATCTGCCACAGTTGAACAGTGAAATTGCAGTGTAGAAAGAAGTGTTTTACTGTCTCTGT
ATCCTTACCACATAAGGAGCATCTGTTGCATAAAGATATACCGCTCTTGGCCACATTGTCCAATGTCAAAACTGCTTCATTGGCTAGCAGCCAGGTGAAG
CATGCCACTTTTTGTGGCACTTTGACTCTCCAAATTTGCTTCCAAGGCCATCTGAAATCTTGATTCTCCATAAGACTGGTTTGTTTATATCCCTCATTCA
CCCTGTTTCTTCCTTTGTTGTGCCAATGCCACCATAAATAGTCTTCACCTGGTTGGATTCCTTGGAAACTCTCCAGTAGTTTGAAAAGTTCAATCATTCT
GGGAATTTCCCAGTCATTCAAGTTTCTTCTAAAGATCATATTCCATCCTTGTGGTGACCACATTTCAGCAACAGTTATGTTGAGCCAAAACAAAGATGTC
AGGAAAGAGATCTTTAAAGCTCACAGTACCCACCTATTTATCAATC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954671
Expected error %
0.0798677
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40556.1| Score 102 E Value 5e-22 Identity 32.60% Align. Length 568bp (87.93%) Frame 2
hypothetical protein PGEC542.21 [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE03883.2| Score 73 E Value 7e-12 Identity 10.00% Align. Length 437bp (67.65%) Frame 1
OSJNBb0015N08.11 [Oryza sativa (japonica cultivar-group)] emb|CAD41785.1| OSJNBa0035M09.1 [Oryza sativa (japonica cultivar-group)] ref|XP_473799.1| OSJNBb0015N08.11 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0034K10
Clone
Clone name
hba-34k10
LE_HBa0034K10
C07HBa0034K10
P034K10
Clone type
BAC
Contamination
none
Estimated length
71,867
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found