Clone Read LE_HBa0166C09_SP6_78064

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0166C09_SP6_78064
Primer
SP6
ID from Seq. Facility
LE_HBa_166_C09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
545 trimmed for vector and quality, 866 raw
Sequence
>LE_HBa0166C09_SP6_78064 (raw untrimmed)
TTTCAATTTTCGACCCAACACAAACTTATCAGACGCAGGCCTCCACCATCTTCTCCCTTAAAAGAGCTCCCCTTCGACCCTTGACTAGGTCGAGATTCGG
GTCGACCTCATCATCACCATCAATAGCAAGATCAATATGTGGGTGGTCGTCAAGTGTAGATAACGGGATGTTAAGCGACAAAGCTTGTTCTTCAGTACGC
TTTGAAGTGGGAACTCCTACAATGTTCGTGAGTTGGCCCGATGAAAGAAGCTCACCCAATTTAGCGACAACGAAAGCTGCTGTTGACCCAGTGCCTAAAC
CAAGGACCATTCCACTTTTGACATACTCAACGGCCTTATCGGCTGCTAGTTTCTTAAGTTCATCTTGGGTTAAAGGTGAAGGAACGGGTGCAGAGAAGGC
TTTAATTGAAGGGGTTGTGGAGCGAATGCGGATAGTGGGGTTGCGCAAGAAGATGGAAGGAAGACGGGTGCCAATAATGGAACTGTGACGGAGAGTAGAA
GAAGAAGAAGAAGAAGGAGAGTGAGGTGAGATTAGGGATAACGAAGCCATGGGGGGTGATGAATTTTTTGGTCTATCCTTTTCTTGGTTTTTTTTGGTCT
TGGTCTATAAATTTCTATAATGACTTCTGTGGGACTGGGTGGTGCTAAGTTTTTTTGATTTTTCTTTTACTTTTTGTTCTTTATATTATTTATAATTTTT
TTCGTGTATTTTTTACTCTTTCTTTGTTTTTTTTTTTTTTCCTAATGTTTTTATTTTACTTCTTTACTCTCATGCTTATTTTTATCTTACCCTTTCTGGT
TTAATTTTACTTTCTACACATTTTTGTTCATTTTTATATTTATTCCGTATTTTATTTTATCTTTTT
>LE_HBa0166C09_SP6_78064 (trimmed for quality and cloning vector)
AACTTATCAGACGCAGGCCTCCACCATCTTCTCCCTTAAAAGAGCTCCCCTTCGACCCTTGACTAGGTCGAGATTCGGGTCGACCTCATCATCACCATCA
ATAGCAAGATCAATATGTGGGTGGTCGTCAAGTGTAGATAACGGGATGTTAAGCGACAAAGCTTGTTCTTCAGTACGCTTTGAAGTGGGAACTCCTACAA
TGTTCGTGAGTTGGCCCGATGAAAGAAGCTCACCCAATTTAGCGACAACGAAAGCTGCTGTTGACCCAGTGCCTAAACCAAGGACCATTCCACTTTTGAC
ATACTCAACGGCCTTATCGGCTGCTAGTTTCTTAAGTTCATCTTGGGTTAAAGGTGAAGGAACGGGTGCAGAGAAGGCTTTAATTGAAGGGGTTGTGGAG
CGAATGCGGATAGTGGGGTTGCGCAAGAAGATGGAAGGAAGACGGGTGCCAATAATGGAACTGTGACGGAGAGTAGAAGAAGAAGAAGAAGAAGGAGAGT
GAGGTGAGATTAGGGATAACGAAGCCATGGGGGGTGATGAATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.985222
Expected error %
0.29154
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g04790.1 Score 180 E Value 5e-46 Identity 24.30% Align. Length 410bp (75.23%) Frame 2
68416.m00516 ribose 5-phosphate isomerase-related similar to ribose-5-phosphate isomerase GI:18654317 from [Spinacia oleracea]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g01290.1 Score 166 E Value 1e-41 Identity 23.90% Align. Length 359bp (65.87%) Frame 2
68415.m00043 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL77589.1| Score 191 E Value 9e-48 Identity 26.20% Align. Length 377bp (69.17%) Frame 2
ribose-5-phosphate isomerase [Spinacia oleracea]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF04905.1| Score 180 E Value 2e-44 Identity 24.30% Align. Length 410bp (75.23%) Frame 2
putative ribose 5-phosphate isomerase [Arabidopsis thaliana] gb|AAN13169.1| putative ribose 5-phosphate isomerase [Arabidopsis thaliana] gb|AAK76459.1| putative ribose 5-phosphate isomerase [Arabidopsis thaliana] gb|AAG51427.1| putative ribose 5-phosphate isomerase; 91580-90750 [Arabidopsis thaliana] ref|NP_187130.1| ribose 5-phosphate isomerase-related [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0166C09
Clone
Clone name
hba-166c9
LE_HBa0166C09
C01HBa0166C09
P166C09
Clone type
BAC
Contamination
none
Estimated length
97,118
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found