Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0166O05_SP6_78632

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0166O05_SP6_78632
Primer
SP6
ID from Seq. Facility
LE_HBa_166_O05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
51 trimmed for vector and quality, 827 raw
Sequence
>LE_HBa0166O05_SP6_78632 (raw untrimmed)
GGGGGGGGCAAGGTTTTTTAAACTCAAGTTATAATAATTACACTTTAACCCATTTTTAATATTATAAATACACATATCCCCATAGAGCGCNNACAAAANC
ANCNNAACNCANNNCGCAAATCTTTTAGGGGGANANCCNCACAACGCGCAACGCGCAAGAGACAANCANAACNCCANCNCCAGNAAAAGCGACAAAGCAC
GAGAAGACANACACCCCAANCNGCAACGCGAAANGGCAGACGAAAGCAACAAACAGAGGNAGACCAGCGCACANCCGCNANCAAGNACGGGCCGGAGNCA
CAAAGCACAAGCCACAACAAANCACAAGCNGCAACAANCGANNGAACGNCCCCAAAGAACGCAGGCGNGNGGNACACNCANNCCANAANANNNANANNNN
ANNNANNNGNCNNNACANNNGNGNNANNANNANNNNNANAANACACNNNANACANAANNAAGNANGAGNNCNAGCAAAAAAAANAGCGGNAAAGGAAAAG
AGAAAGCACAAGAAAANGAAGAAAGNAGACNNANNAAANNANNNAANNNNGGNAAAAAANAGNAAAGAAAAAAAGAGNCGNAAAAGNGGNNGNACNNCAN
CNAAANCAACGAGNAGAGNNANANNNAACANAAANGAANCNACNNANGNNGANGANNCNCCNNANGAAANNGAGNCAAANGNNCAACNCGAACACGAAAA
GCNAGAACGAAGCAAAGGCAAAAAAAACCCCAACGANGAAGAAAAACCAGGAGAAGAAGAAGAAAAAGAAACGGGAGAAAAAGGAGCAAGAAAAAAAACC
GAGAAAACCCGGGGAACAAAAGGACCA
>LE_HBa0166O05_SP6_78632 (trimmed for quality and cloning vector)
GTTATAATAATTACACTTTAACCCATTTTTAATATTATAAATACACATATC

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.646125
Expected error %
0.0539829
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0166O05
Clone
Clone name
hba-166o5
LE_HBa0166O05
P166O05
Clone type
BAC
Contamination
none
Estimated length
84,688
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found