Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0166O05_T7_78633

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0166O05_T7_78633
Primer
T7
ID from Seq. Facility
LE_HBa_166_O05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
698 trimmed for vector and quality, 782 raw
Sequence
>LE_HBa0166O05_T7_78633 (raw untrimmed)
CCTGGGATCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTAGCGGCGCAAAGTAGGCAAAAAGAATATGCAGATCGAAAGGTTAGAGAC
TTAGAGTTCATGGAAGGTGAACAAGTCTTATTGAAAGTTTCGCCAATGAAAGGGGTGATGCGGTTTGGTAAAAGAGGCAAGCTAAGCCCAAGGTACATCG
GTCCCTTTGAAGTACTTAAGCGAGTAGGGGAGGTGGCTTATGAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGTGCATCCGGTATTCCATGTGTCTATGTT
GAAAAGATACCATGGGGATGGAAACTACATTATCCGTTGGGATTCGGTCCTGCTTGATGAGAATTTGTCTTATGAGGAGGAACCTGTTGCTATCTTAGAT
AGAGAAGTCCGCAAGTTGAGGTCGAGGGAGATTGCATCCATCAAGGTGCAATAGAAGAATCGGCCGGTTGAAGAAGCTACTTGGGAGAAGGAGATCGATA
TGCAAGAAAGATACCCACACCTGTTTAAAGATTCAGGTACTCCTTCTCGCCCTTGTTTTTCTTCTTGTGATCGTTCGAGGACGAACGATGGGTAAATTGG
TATCTATTGTAATGACCTGTTTAGTCGTTTTGAGCAGCAGATTTTATTTCTGGAAAACTGGCTGAAACGATGGGCCCCACGATGGACCGTCATGGGCACG
ATGGGCCCTCGAGCGTGTCTCGTTCCAAAAACACTTTAGAAATTCCGGAATCGAATAACTGAAATGAACTCTCTGAACTCTG
>LE_HBa0166O05_T7_78633 (trimmed for quality and cloning vector)
AGCTTCTAGCGGCGCAAAGTAGGCAAAAAGAATATGCAGATCGAAAGGTTAGAGACTTAGAGTTCATGGAAGGTGAACAAGTCTTATTGAAAGTTTCGCC
AATGAAAGGGGTGATGCGGTTTGGTAAAAGAGGCAAGCTAAGCCCAAGGTACATCGGTCCCTTTGAAGTACTTAAGCGAGTAGGGGAGGTGGCTTATGAG
TTAGCCTTGCCTCCAGGGCTGTCCGGAGTGCATCCGGTATTCCATGTGTCTATGTTGAAAAGATACCATGGGGATGGAAACTACATTATCCGTTGGGATT
CGGTCCTGCTTGATGAGAATTTGTCTTATGAGGAGGAACCTGTTGCTATCTTAGATAGAGAAGTCCGCAAGTTGAGGTCGAGGGAGATTGCATCCATCAA
GGTGCAATAGAAGAATCGGCCGGTTGAAGAAGCTACTTGGGAGAAGGAGATCGATATGCAAGAAAGATACCCACACCTGTTTAAAGATTCAGGTACTCCT
TCTCGCCCTTGTTTTTCTTCTTGTGATCGTTCGAGGACGAACGATGGGTAAATTGGTATCTATTGTAATGACCTGTTTAGTCGTTTTGAGCAGCAGATTT
TATTTCTGGAAAACTGGCTGAAACGATGGGCCCCACGATGGACCGTCATGGGCACGATGGGCCCTCGAGCGTGTCTCGTTCCAAAAACACTTTAGAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978712
Expected error %
0.503181
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 216 E Value 4e-55 Identity 21.00% Align. Length 494bp (70.77%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 209 E Value 4e-53 Identity 20.60% Align. Length 494bp (70.77%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0166O05
Clone
Clone name
hba-166o5
LE_HBa0166O05
P166O05
Clone type
BAC
Contamination
none
Estimated length
84,688
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found