Clone Read LE_HBa0016D03_SP6_78868

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0016D03_SP6_78868
Primer
SP6
ID from Seq. Facility
LE_HBa_016_D03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
833 trimmed for vector and quality, 858 raw
Genbank Accession
Sequence
>LE_HBa0016D03_SP6_78868 (raw untrimmed)
GGCCAGCATGGTTGATTGATGAGAGCTGCTTCGATTCGAAAAGAGGCGTTACAGAGGATCACAGGGAAGTCATTGGAAGGGCTCCCATTGGAAGGATTTG
ACTATGAGTCTATTCTTGGACAATGCTGTGAGATGCCTGTAGGATATGTGCAAATACCGGTTGGTATTGCAGGGCCTTTGTTGCTTGATGGGAGAGAGTA
CTCAGTGCCAATGGCAACTACAGAAGGGTGTTTAGTTGCTAGCACCAACAGGGGTTGCAAGGCTATCTTTGTCTCTGGTGGCGCCAACAGCATTTTGCTC
AGAGATGGCATGACAAGAGCTCCGGTTGTCCGGTTCACCACCGCCAAAAGAGCCGCAGAGTTGAAATTCTTCGTTGAGGATCCCCTTAACTTTGAGATTC
TTTCTCTTATGTTCAACAAGTGAGTTTTCTTCTCATGATTACGTATATTCTTAATTGTTTCTTCTACGAGTACTAGCTATTCGTAATTGGTGAGCTTTTT
GTTAAAAGATTGGAGGATGCTTACCATTTTAGCAATCCGTTGTTGGTGAGAGTTAGTATGAAACAATTAAGACAAAACATTTAAGTTTTGCTTCTCTCTT
AATTCTATATCTTGATTCAATATTTTCTGTTACAAATTCTTTATTCACCAGCAAAGAGAAAAGAAATGATTTGTCATATCTAGTATCCTAATTGAAAGCT
TATGTTAAAAGTTACATGTCATGTGCATTTTTATTCAATATTATGTTTTCAAAATTTAAAATTTGTTTCTGTAATGGAAATTTTTGCAGATCAAGCAGAT
TTGCTCGATTACAGGGCATTCAATGTGCTATAGCTGGTAAAAATCTGTATATGAGATT
>LE_HBa0016D03_SP6_78868 (trimmed for quality and cloning vector)
GAGAGCTGCTTCGATTCGAAAAGAGGCGTTACAGAGGATCACAGGGAAGTCATTGGAAGGGCTCCCATTGGAAGGATTTGACTATGAGTCTATTCTTGGA
CAATGCTGTGAGATGCCTGTAGGATATGTGCAAATACCGGTTGGTATTGCAGGGCCTTTGTTGCTTGATGGGAGAGAGTACTCAGTGCCAATGGCAACTA
CAGAAGGGTGTTTAGTTGCTAGCACCAACAGGGGTTGCAAGGCTATCTTTGTCTCTGGTGGCGCCAACAGCATTTTGCTCAGAGATGGCATGACAAGAGC
TCCGGTTGTCCGGTTCACCACCGCCAAAAGAGCCGCAGAGTTGAAATTCTTCGTTGAGGATCCCCTTAACTTTGAGATTCTTTCTCTTATGTTCAACAAG
TGAGTTTTCTTCTCATGATTACGTATATTCTTAATTGTTTCTTCTACGAGTACTAGCTATTCGTAATTGGTGAGCTTTTTGTTAAAAGATTGGAGGATGC
TTACCATTTTAGCAATCCGTTGTTGGTGAGAGTTAGTATGAAACAATTAAGACAAAACATTTAAGTTTTGCTTCTCTCTTAATTCTATATCTTGATTCAA
TATTTTCTGTTACAAATTCTTTATTCACCAGCAAAGAGAAAAGAAATGATTTGTCATATCTAGTATCCTAATTGAAAGCTTATGTTAAAAGTTACATGTC
ATGTGCATTTTTATTCAATATTATGTTTTCAAAATTTAAAATTTGTTTCTGTAATGGAAATTTTTGCAGATCAAGCAGATTTGCTCGATTACAGGGCATT
CAATGTGCTATAGCTGGTAAAAATCTGTATATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960087
Expected error %
0.117701
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g76490.1 Score 229 E Value 1e-60 Identity 26.80% Align. Length 398bp (47.78%) Frame 3
68414.m08899 3-hydroxy-3-methylglutaryl-CoA reductase 1 / HMG-CoA reductase 1 (HMG1) identical to HMG-CoA reductase 1 [SP|P14891]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g17370.1 Score 216 E Value 1e-56 Identity 26.80% Align. Length 398bp (47.78%) Frame 3
68415.m02006 3-hydroxy-3-methylglutaryl-CoA reductase 2 / HMG-CoA reductase 2 (HMGR2) identical to SP|P43256 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2 (EC 1.1.1.34) (HMG- CoA reductase 2) (HMGR2) {Arabidopsis thaliana}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB04043.1| Score 265 E Value 1e-69 Identity 33.30% Align. Length 398bp (47.78%) Frame 3
HMGR CoA reductase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|P48020|HMD1_SOLTU Score 259 E Value 8e-68 Identity 32.30% Align. Length 398bp (47.78%) Frame 3
3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 (HMG-CoA reductase 1) (HMGR1) (HMGR) gb|AAA93498.1| hydroxymethylglutaryl coenzyme A reductase pir||S59944 hydroxymethylglutaryl-CoA reductase (NADPH2) (EC 1.1.1.34) - potato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0016D03
Clone
Clone name
hba-16d3
LE_HBa0016D03
C02HBa0016D03
P016D03
Clone type
BAC
Contamination
none
Estimated length
107,579
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found