Clone Read LE_HBa0016G13_SP6_79032

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0016G13_SP6_79032
Primer
SP6
ID from Seq. Facility
LE_HBa_016_G13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
803 trimmed for vector and quality, 880 raw
Genbank Accession
Sequence
>LE_HBa0016G13_SP6_79032 (raw untrimmed)
GGGCAGCATTCTTCTCATCTCNGATCTCCAAGCCATTTATCCAAGAGGACTTTGTTAAAAACCTTCAAGTCTTTAACCCCAAGTCCTCACCACTGTTTAG
GAGATGTCACGGTCTCCCGTCCCACTAGGTGAAACTTCTTTGTCCCATCCGCCGCATCCCAAATGTTCCTTTGCTACCTTTCCAGCTTTTCTATAACTCC
ACACCAAGTGCGTTGAGCTGGGACATGCGATATTTTACCATCCTGTACAACTCTGGAGCATTTCTGCATCTTTTTACCCATTCTCCCAATTCAAACCTCT
CTGTGTATCTATAACATCGAATTCGTATGACCTCCCACAAGTGAGGTTACGCTTACTTTACCCCACCTTTGATAAGTAACAACAAAATTTAAACCTAACT
GCAACAGGCATTACTATCATAGGTTCCTTAACTCATACCACATAGAACTAGACTTTGGCAGAAACAACTAAAGTGAGAGACCAGCTTCTTAACTCTAGAG
AAAATCTCAGGTGCCTAAGTTCATGCATATATCATAAAAAGCTATCCTTTTTTCAGTTTATTTACAACACCCAGTTTCCCACCACTTCAGTAGAACATTT
AAAAATCAGAGCAATAACAAAAAGCTATCCTTTTTTCAGCATTAAAACTTAACTGAAAACAAAAAAGATGAGCTCATGAAGCTTACATGACCATGAGGCT
CAATTTGCCAAATACGAGCTGTTTGATCCACAGAACCTGAAGCTAATTTCGTGCCACTGCAGTTCCATGCCACCGAATGCACCTTTAATTTTTTTAAAAA
AACAGAGAAAAAAAGTATCACATAGTCAATTCATCTAATCAGAAAGTTCATAAAAAGGAAAACAAAATTTAGGTTGTATT
>LE_HBa0016G13_SP6_79032 (trimmed for quality and cloning vector)
AAGCCATTTATCCAAGAGGACTTTGTTAAAAACCTTCAAGTCTTTAACCCCAAGTCCTCACCACTGTTTAGGAGATGTCACGGTCTCCCGTCCCACTAGG
TGAAACTTCTTTGTCCCATCCGCCGCATCCCAAATGTTCCTTTGCTACCTTTCCAGCTTTTCTATAACTCCACACCAAGTGCGTTGAGCTGGGACATGCG
ATATTTTACCATCCTGTACAACTCTGGAGCATTTCTGCATCTTTTTACCCATTCTCCCAATTCAAACCTCTCTGTGTATCTATAACATCGAATTCGTATG
ACCTCCCACAAGTGAGGTTACGCTTACTTTACCCCACCTTTGATAAGTAACAACAAAATTTAAACCTAACTGCAACAGGCATTACTATCATAGGTTCCTT
AACTCATACCACATAGAACTAGACTTTGGCAGAAACAACTAAAGTGAGAGACCAGCTTCTTAACTCTAGAGAAAATCTCAGGTGCCTAAGTTCATGCATA
TATCATAAAAAGCTATCCTTTTTTCAGTTTATTTACAACACCCAGTTTCCCACCACTTCAGTAGAACATTTAAAAATCAGAGCAATAACAAAAAGCTATC
CTTTTTTCAGCATTAAAACTTAACTGAAAACAAAAAAGATGAGCTCATGAAGCTTACATGACCATGAGGCTCAATTTGCCAAATACGAGCTGTTTGATCC
ACAGAACCTGAAGCTAATTTCGTGCCACTGCAGTTCCATGCCACCGAATGCACCTTTAATTTTTTTAAAAAAACAGAGAAAAAAAGTATCACATAGTCAA
TTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95096
Expected error %
0.394962
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g56130.1 Score 70 E Value 2e-12 Identity 29.50% Align. Length 104bp (12.95%) Frame 2
68418.m07002 transducin family protein / WD-40 repeat family protein contains 5 WD-40 repeats (PF00400); similar to beta transducin-like protein HET-E2C*4 (GI:17225206) [Podospora anserina]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15493.1| Score 70 E Value 9e-11 Identity 29.50% Align. Length 104bp (12.95%) Frame 2
unknown protein [Arabidopsis thaliana] dbj|BAB09295.1| unnamed protein product [Arabidopsis thaliana] gb|AAM13119.1| unknown protein [Arabidopsis thaliana] ref|NP_200424.1| transducin family protein / WD-40 repeat family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0016G13
Clone
Clone name
hba-16g13
LE_HBa0016G13
C07HBa0016G13
P016G13
Clone type
BAC
Contamination
none
Estimated length
66,703
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found