Clone Read LE_HBa0016G13_T7_79033

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0016G13_T7_79033
Primer
T7
ID from Seq. Facility
LE_HBa_016_G13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
615 trimmed for vector and quality, 879 raw
Genbank Accession
Sequence
>LE_HBa0016G13_T7_79033 (raw untrimmed)
TCAACTTGGTTCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCCCTTAATATCCCAGCTGCCTTTTAGGGGCAAGATCTCCAATTAC
TCTCATCTGTCTCCAACTTTAACTCATGGCACTTTAGTATTACATCCAGTGCCTCTTTACATTTCTTGGTATCACCATTGTGGTTAAAAATACTAGCAAT
TTCGTTGGCATCTGTGTTAAAGAACAAAGGAATCAAGTTCTTCTTTTGCGCGAAGAATCTTATTTCCTCCAAGCTATGATGGTTGGAGAAGCTACAACCA
GTGACAACTATGACACCAAAGGTGACTGAGCATATAACTTTGTCAGCAATCTCATGGCTCTGATTATCTGCATACTTTGCTCTATCAGCAATAAAACAAG
CAATTCCCTGAAGCTCAAGTTCTGATTTGAGCCACTTACAGAAGCGTACTAAATTCGGGTTCTGACCATGGAATCCTATATACACATCACAGCTCCTAAG
TTTAGCATTGGAAGCAGGTGAAACCGACCCCTTGGCAAACGAAATTCGAGGGACAGGGAAAGAAAATGATATCCTGGGATCGGTTTCCGGTCCAGAAACT
GGGACACAGGTGACCATCTTGAGCTTTTGTGTCTGTCGGATCATCAGAAAAAATCATATCTTTTCTGGTGGTGGAGTGTAGGAGGTGCTGGGAACATTAT
TCAAATTGCAAGCCTCATAATAATACTGGTGTGGATGGATGTAAAACTAACGACACAAGAATATAGGTATTACCTGATTTGTTTTTGAAATTAAATGCTA
CTGTGATAATGTATGAGATTGTAGAGTAGAATGAAAGACAAGTATTATGGAGGATTTTTCATTGTGCTTCTCTGTTCCT
>LE_HBa0016G13_T7_79033 (trimmed for quality and cloning vector)
AGCTTGGCCCTTAATATCCCAGCTGCCTTTTAGGGGCAAGATCTCCAATTACTCTCATCTGTCTCCAACTTTAACTCATGGCACTTTAGTATTACATCCA
GTGCCTCTTTACATTTCTTGGTATCACCATTGTGGTTAAAAATACTAGCAATTTCGTTGGCATCTGTGTTAAAGAACAAAGGAATCAAGTTCTTCTTTTG
CGCGAAGAATCTTATTTCCTCCAAGCTATGATGGTTGGAGAAGCTACAACCAGTGACAACTATGACACCAAAGGTGACTGAGCATATAACTTTGTCAGCA
ATCTCATGGCTCTGATTATCTGCATACTTTGCTCTATCAGCAATAAAACAAGCAATTCCCTGAAGCTCAAGTTCTGATTTGAGCCACTTACAGAAGCGTA
CTAAATTCGGGTTCTGACCATGGAATCCTATATACACATCACAGCTCCTAAGTTTAGCATTGGAAGCAGGTGAAACCGACCCCTTGGCAAACGAAATTCG
AGGGACAGGGAAAGAAAATGATATCCTGGGATCGGTTTCCGGTCCAGAAACTGGGACACAGGTGACCATCTTGAGCTTTTGTGTCTGTCGGATCATCAGA
AAAAATCATATCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978157
Expected error %
0.724742
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g56220.1 Score 264 E Value 2e-71 Identity 23.00% Align. Length 578bp (93.98%) Frame 1
68418.m07016 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23440.1 Score 130 E Value 6e-31 Identity 13.70% Align. Length 482bp (78.37%) Frame 1
68417.m03379 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC42065.1| Score 264 E Value 1e-69 Identity 23.00% Align. Length 578bp (93.98%) Frame 1
unknown protein [Arabidopsis thaliana] dbj|BAB09113.1| unnamed protein product [Arabidopsis thaliana] gb|AAO63925.1| unknown protein [Arabidopsis thaliana] ref|NP_200433.1| expressed protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79299.1| Score 130 E Value 2e-29 Identity 13.70% Align. Length 482bp (78.37%) Frame 1
hypothetical protein [Arabidopsis thaliana] emb|CAA20465.1| hypothetical protein [Arabidopsis thaliana] ref|NP_194075.1| expressed protein [Arabidopsis thaliana] pir||T05382 hypothetical protein F16G20.140 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0016G13
Clone
Clone name
hba-16g13
LE_HBa0016G13
C07HBa0016G13
P016G13
Clone type
BAC
Contamination
none
Estimated length
66,703
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found