Clone Read LE_HBa0021C10_T7_79603

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0021C10_T7_79603
Primer
T7
ID from Seq. Facility
LE_HBa_021_C10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
367 trimmed for vector and quality, 844 raw
Sequence
>LE_HBa0021C10_T7_79603 (raw untrimmed)
CCCCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAACACGAGTTATTTGAAGTTCCTTCTTTAAGGTCAACAACTCGACAGTAA
AGACGTCCGCTTGCTATCCTTCTAAACGTATTCATGCGTGATGGGCACTTAGATTCGAGGATAGAAGAAACGATGGTTAAAATCCCTCTTTCAAAGATTT
TAAAACGGGCCTCCTTGAGTGGAGGCGGTTTCTTTGGATGGATACACTGCCCCAGATCGATTAAAACCCACTGATTTTGACGAAAACCCTGACCACAAGC
AGCCGCATCAAGCCCTTATCGGGTTCCAGCTTCCAGGGTAACCTGAGACAGTCTTCTAACACGGAGGGGGTTTGGACTGGAGGACCCGAAGTCTAACTTC
AGGTCTTAGAGTAGAAAAATCCTCAGTATACCTTAATACATCCTAAAATAACCATCCATGGTACATTCAACAGAAGGGGGGAGTTGTCTAGACGCCCCGG
ATCCCCTGCATAAGCTAAATCCTATGGCAACCCCAAAAACGCCCAATCCAACCAGTGAGTTGTTTGTTTACCAATGCCCAGAATATTTGGGGACAGCCCT
TACAGAATGAAAAACAATCGATCCCAATGTCTGCTGGAGTAGCGCGACAAAGAATCCCGCACAGGGGACGAAACCATAGTGCCACTGACAAACCTGCCCA
CCTGGCGGCCCGACCCCACCCCCAGCTTGACCCCTGCTGCGTTCCTTATTAACCGCCCCCCCTCTTACTGGCACCATCTTGTTTTGTTTTATCACCTATA
TTGTTCCTCCCACTTCTTATAACCCTACTTGAAACTTATTCTTC
>LE_HBa0021C10_T7_79603 (trimmed for quality and cloning vector)
AGCTTGAACACGAGTTATTTGAAGTTCCTTCTTTAAGGTCAACAACTCGACAGTAAAGACGTCCGCTTGCTATCCTTCTAAACGTATTCATGCGTGATGG
GCACTTAGATTCGAGGATAGAAGAAACGATGGTTAAAATCCCTCTTTCAAAGATTTTAAAACGGGCCTCCTTGAGTGGAGGCGGTTTCTTTGGATGGATA
CACTGCCCCAGATCGATTAAAACCCACTGATTTTGACGAAAACCCTGACCACAAGCAGCCGCATCAAGCCCTTATCGGGTTCCAGCTTCCAGGGTAACCT
GAGACAGTCTTCTAACACGGAGGGGGTTTGGACTGGAGGACCCGAAGTCTAACTTCAGGTCTTAGAG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.976069
Expected error %
5.3765
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0021C10
Clone
Clone name
hba-21c10
LE_HBa0021C10
P021C10
Clone type
BAC
Contamination
none
Estimated length
145,249
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found