Clone Read LE_HBa0021C23_SP6_79628

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0021C23_SP6_79628
Primer
SP6
ID from Seq. Facility
LE_HBa_021_C23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
653 trimmed for vector and quality, 763 raw
Genbank Accession
Sequence
>LE_HBa0021C23_SP6_79628 (raw untrimmed)
AAGGTCGTCGTATGCAGCGAACTCANCTTTAAATCTTTCTACTTTGCCGGAGCCATCCATTTAGAAGGGATTAAAATGGGATTCATATCTGATGATAAGT
CGATACCAAAGTCTATTTACCGCTTGAGAGTAATTTCTTGCAAGTCGTCAGGACAGACTTTCGGATAGTCCTTCACTACGGGGACCGACTCTATAGGAGG
AATGTTGGACTAAATATATTTGACTCTTACAATATAGCAAAGAAAACCTTTAGAGATCATTTTACAATATTTTAAACAAGAGATGATAGACCTCTAGGAA
TTGAGTTACCCCTCTTTCACTCTAAGATGGATTCATTAGGAAAATTGAACTCAACCACTCTTTTACAACAATTAGTGGAAGCAAAATAAGCATACAACCA
ATCCATTCCCAATATGACATCAAAATCAATCATATTAAGCTCTATCAAATCCACCCATGTAACTCTTTTGGAGAAGATATAAAAGAACACCAAAATATTC
TTCTAGCCATAATGAAGTCACCAATCGGGGTTGTAACTATAAATGGTTCAATCAAAATATCGGGTAGAACATGAAACGTTTTATCTACTAGAGGAGTTAT
AAATGACAAGGTAGCACCAGGATAAAGTAGAGCATATACATCAATAGAGAAGACTTGTAACATACCGGTGACTACATCGGTGGACTCCTCTTGCTCACCC
CTAGAGCCGAGAGCATAAAAGTGATTTCTCTTTGGATCTTCCAAACTAAGACCACTTGCTTGG
>LE_HBa0021C23_SP6_79628 (trimmed for quality and cloning vector)
CTTTCTACTTTGCCGGAGCCATCCATTTAGAAGGGATTAAAATGGGATTCATATCTGATGATAAGTCGATACCAAAGTCTATTTACCGCTTGAGAGTAAT
TTCTTGCAAGTCGTCAGGACAGACTTTCGGATAGTCCTTCACTACGGGGACCGACTCTATAGGAGGAATGTTGGACTAAATATATTTGACTCTTACAATA
TAGCAAAGAAAACCTTTAGAGATCATTTTACAATATTTTAAACAAGAGATGATAGACCTCTAGGAATTGAGTTACCCCTCTTTCACTCTAAGATGGATTC
ATTAGGAAAATTGAACTCAACCACTCTTTTACAACAATTAGTGGAAGCAAAATAAGCATACAACCAATCCATTCCCAATATGACATCAAAATCAATCATA
TTAAGCTCTATCAAATCCACCCATGTAACTCTTTTGGAGAAGATATAAAAGAACACCAAAATATTCTTCTAGCCATAATGAAGTCACCAATCGGGGTTGT
AACTATAAATGGTTCAATCAAAATATCGGGTAGAACATGAAACGTTTTATCTACTAGAGGAGTTATAAATGACAAGGTAGCACCAGGATAAAGTAGAGCA
TATACATCAATAGAGAAGACTTGTAACATACCGGTGACTACATCGGTGGACTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952843
Expected error %
0.251936
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38790.1| Score 79 E Value 1e-27 Identity 46.20% Align. Length 406bp (62.17%) Frame 2
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 79 E Value 1e-27 Identity 46.20% Align. Length 406bp (62.17%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0021C23
Clone
Clone name
hba-21c23
LE_HBa0021C23
C02HBa0021C23
P021C23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found