Clone Read LE_HBa0021C23_T7_79629

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0021C23_T7_79629
Primer
T7
ID from Seq. Facility
LE_HBa_021_C23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
291 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0021C23_T7_79629 (raw untrimmed)
ATAAACTCCTCCCGCGCGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGTACCAAATGACGATCTACCTTACGGTCCATCGCTGGACTTACTGG
GCATCATTTCAGACCCTCGATGCAGGTTCTGTAAAACTGCCATGAACACTGTCTTATTATGGGGTGAATGGAAAATTCACCCCACGTGCAAACCTGACCC
TAATCAGTTTATTTGGTTTTTTTGGGTGTAATTAGGTGATCCAAAACATGATTAGGCCATTCTCAATTTATTCGTCAAATTAAAACCCTTCCCCCTAAAA
AAGATACCTCTCTAAAATTCTCAACTGAATGTGAATCTCAATATCACCATGCATATGGGATTTACATCGGTTATTAACCAAGTATATATCGACCCATTCT
TCTATCACCGGTATCGTTATCCTCCCTCCCTAACCAATCTCTCATTTCGGAGACTCTTTTCCCACTTCCTCTTCTTGAACTTTTCCTAGAACCAATTTAT
CTCTCATTCCACCCTCCCCCCGGCTTCCCTACTCAACTTTCTCTCCAATACTACACCTCTCTATCCCCATACCCCTTTTCCTTATCAATTATTATACTCT
TCTTTAGCGTATTCATTCTTATTCTCCCATTTTTTTATTCTCTACATTTTTCCCTTGTTCTTCTTCTACTTTCTATCCTATTTTTTTTCTAATCCTCTCG
CCTCCTAATTTAAACAACTATATTAACATAATTCTTCTCCCCACTCCCCCCTTCACCCTCCCTCTCCTCCACATCTCCATTCCCACTCTTATACTTCTTC
CCGATATCGACTC
>LE_HBa0021C23_T7_79629 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTAAGTACCAAATGACGATCTACCTTACGGTCCATCGCTGGACTTACTGGGCATCATTTCAGACCCTCGATGCAGGTTCTGT
AAAACTGCCATGAACACTGTCTTATTATGGGGTGAATGGAAAATTCACCCCACGTGCAAACCTGACCCTAATCAGTTTATTTGGTTTTTTTGGGTGTAAT
TAGGTGATCCAAAACATGATTAGGCCATTCTCAATTTATTCGTCAAATTAAAACCCTTCCCCCTAAAAAAGATACCTCTCTAAAATTCTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956311
Expected error %
0.966827
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0021C23
Clone
Clone name
hba-21c23
LE_HBa0021C23
C02HBa0021C23
P021C23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found