Clone Read LE_HBa0021F09_T7_79745

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0021F09_T7_79745
Primer
T7
ID from Seq. Facility
LE_HBa_021_F09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
524 trimmed for vector and quality, 835 raw
Sequence
>LE_HBa0021F09_T7_79745 (raw untrimmed)
ACTGGGGACCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAATGCATGGTAGTATATTCCCTTTAAGGTGTCCTTGTTTAGCTGCTGA
GCCTATACATAGCCCTAGAAGAAGANCAGAACAANCNGCACAAAGGNACAGCNAGAAAAGAAGANAGACAAAACNNACCNCCNGGGAANCAAANGCCANG
CCAAGCAAAANGAAGGNGNCNGCAAGNCCCNGGACNCCAAGNCCAANAGGCCNANGNCGNAAGNNAGACCNNNNNGCAGNNNCAACAGGGNAGNAANNGA
CGNCAANAANNNNGNNCAGGGNAGAAGNGACNAANGCAGNGACCNGNCNCACANGGCAAACAGAGCAAAANNAAGAANAANGNCAAGAGAAACANGNNCA
AGAAAGNNGGNANNNAGAACAAAACAAACCNCNGCCAANNNGNCAAAANCAAAGNANCGANANNAAGAACCCCNACNCCCCACAAGCNNAGAAGGCAGNG
ANNCACCNGGGACCCCCNGAAAGANANAAAGGCAACACNACACNAAGAGGCAAGGAGAAAGNAGGACAAGNAAGNNNNAAGNAGANACCAAGGNNAACNA
CCNNCNCNCNAACANANCAAGGNAGAGCAAAAGAAGCAAGAANGCAAACAGCAGANACAGAAGGACAAGAGAACACAAAAACCACAGGACACAAGAGAGA
AGACGGGAAAGGGCCAAGAACCAGCCGGAGGCCAAAACCAAAGCAAGAACCCCACAAAAACAAACAGAAAAAGGGAGAAGAAAAAAAACCGCCCCCCAAC
AAACAAGGAAAAAGCAAAACAGAAAGGCAGGAAAA
>LE_HBa0021F09_T7_79745 (trimmed for quality and cloning vector)
AGCTTTTAATGCATGGTAGTATATTCCCTTTAAGGTGTCCTTGTTTAGCTGCTGAGCCTATACATAGCCCTAGAAGAAGANCAGAACAANCNGCACAAAG
GNACAGCNAGAAAAGAAGANAGACAAAACNNACCNCCNGGGAANCAAANGCCANGCCAAGCAAAANGAAGGNGNCNGCAAGNCCCNGGACNCCAAGNCCA
ANAGGCCNANGNCGNAAGNNAGACCNNNNNGCAGNNNCAACAGGGNAGNAANNGACGNCAANAANNNNGNNCAGGGNAGAAGNGACNAANGCAGNGACCN
GNCNCACANGGCAAACAGAGCAAAANNAAGAANAANGNCAAGAGAAACANGNNCAAGAAAGNNGGNANNNAGAACAAAACAAACCNCNGCCAANNNGNCA
AAANCAAAGNANCGANANNAAGAACCCCNACNCCCCACAAGCNNAGAAGGCAGNGANNCACCNGGGACCCCCNGAAAGANANAAAGGCAACACNACACNA
AGAGGCAAGGAGAAAGNAGGACAA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
1.02239
Expected error %
32.4871
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA71815.1| Score 41 E Value 8e-11 Identity 45.30% Align. Length 470bp (89.69%) Frame 2
ribonucleotide reductase [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0021F09
Clone
Clone name
hba-21f9
LE_HBa0021F09
P021F09
Clone type
BAC
Contamination
none
Estimated length
103,018
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found