Clone Read LE_HBa0001B16_T7_80

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0001B16_T7_80
Primer
T7
ID from Seq. Facility
Le-HBa001_B16-T7.ab1
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
716 trimmed for vector and quality, 1431 raw
Genbank Accession
Sequence
>LE_HBa0001B16_T7_80 (raw untrimmed)
GTACACCGGACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCAAGGTTAGACAATGATATCAACTCCCCTGGGAGCCTCGTCAACGAG
TAGCATTTGAAGATCTGCCCCCTTTGGAGGCCTGCCATTGCACCTTTTCCTAGAAGCATCGCTTTCATAAACACTAGTTGATCCATCCTGAGAACCTTGA
GTCCACGAAACCCATTCTCCGATATTCTTATCCTATACTCTTGATACCTATCATAATGATAAAAGGCTTTGACTAGTTTTAGAACTGACAAGTTGGCTAA
CTTCTCCAATACTTGGATTGAATCTGGATGGAGATTTGAGTTCACCAAAGTCAGCTGACAAAGCTTAGGTGGAAATACGCAAGAATTAACTGGCATTGAT
ACTAAGCCTCCCTTCAACTTAAGCTTGACAACGTGACTCAACTTAGATAAACCAGAAACCAAAAATATTCTCCTTCTACCCTCTACTTCCAAACACAAGG
ATTGAAGGCTCTTAAGCTCTGCAAGTGAATTACATAATTGATTCATGTCTAGGTTATCAGCACTTCCAATGAGTAAACCAACTTTTTGGAGATGAGTCAT
TCTAGTCAGGTTTTGATGGTGCATCCAGTGATGAACAGGTATGCTGCCTAGAGTTTGGAGATTGTTAGGTAGGTCAATCTTTCAATAGGCTGGGGGGATT
TATGTAACCAAGTATATGCCCGTAATTTCTCAAACTTCCATAAGAACATAGGAACTTTTCACAGAAAAAAACCTAGAACATGGGCATATCTATCGTTTCC
AAGTTTTGCAAACCAACTTATTGAAGGGGGGAACTTCTTAAAACTTGTCTTCCATCCTAGGCCCTAATTACTTCAAGGGAACATAATTTTCCCAAAATTA
TTCTTGAAATCCCCTTTTAAACCAGGAAGAGTTTATTGTTAACACTTCTGAAAAAGTTGAAAATTACCCCGTACAAAATACCAATCAGGGGTATATTAAT
TTTAAAAAAAAAAACTCAAAGGGAAAGAAAAAAACTTTTCTTATCCAATTTTTAAATTTTCCAAAATAATTTCTACACCCTCTTTTCCGGGAAAAGAAAA
AGAACACGCGGGGCCAAAAATTGGCGAAAAGGGGGGAAAAAAAAGAGGGGAATAATCCCATCCCCCCAGAAAAAATTTTTTTCTCCCCGCGGGGCCCTTC
CTTTTTACAAAAAAAATCCCCGTTAGAGGAAAATTTAAGGGGAAGGCGCGGCCAAACCTCCTTTAAACTCTTTGTATCTCCTCCCTGGCCCTGTAACACA
ATAGAGAAATTATACCTTTATGAAAAAAACCTGATATTTTTTTCTCCTTCTCAATATATTATACATGTCTTCACCACAACAAATAAAAACAAATAACCCT
CTCCTCCTCCACCTCCAAACGTAAGCTCTCG
>LE_HBa0001B16_T7_80 (trimmed for quality and cloning vector)
AGCTTCTCAAGGTTAGACAATGATATCAACTCCCCTGGGAGCCTCGTCAACGAGTAGCATTTGAAGATCTGCCCCCTTTGGAGGCCTGCCATTGCACCTT
TTCCTAGAAGCATCGCTTTCATAAACACTAGTTGATCCATCCTGAGAACCTTGAGTCCACGAAACCCATTCTCCGATATTCTTATCCTATACTCTTGATA
CCTATCATAATGATAAAAGGCTTTGACTAGTTTTAGAACTGACAAGTTGGCTAACTTCTCCAATACTTGGATTGAATCTGGATGGAGATTTGAGTTCACC
AAAGTCAGCTGACAAAGCTTAGGTGGAAATACGCAAGAATTAACTGGCATTGATACTAAGCCTCCCTTCAACTTAAGCTTGACAACGTGACTCAACTTAG
ATAAACCAGAAACCAAAAATATTCTCCTTCTACCCTCTACTTCCAAACACAAGGATTGAAGGCTCTTAAGCTCTGCAAGTGAATTACATAATTGATTCAT
GTCTAGGTTATCAGCACTTCCAATGAGTAAACCAACTTTTTGGAGATGAGTCATTCTAGTCAGGTTTTGATGGTGCATCCAGTGATGAACAGGTATGCTG
CCTAGAGTTTGGAGATTGTTAGGTAGGTCAATCTTTCAATAGGCTGGGGGGATTTATGTAACCAAGTATATGCCCGTAATTTCTCAAACTTCCATAAGAA
CATAGGAACTTTTCAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.972918
Expected error %
1.31838
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0001B16
Clone
Clone name
hba-1b16
LE_HBa0001B16
P001B16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
3 sequencing reads found