Clone Read LE_HBa0037A05_SP6_80264

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0037A05_SP6_80264
Primer
SP6
ID from Seq. Facility
LE_HBa_037_A05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
484 trimmed for vector and quality, 776 raw
Genbank Accession
Sequence
>LE_HBa0037A05_SP6_80264 (raw untrimmed)
CAGATTATCTTGGAGGAATTGGGCAAGAAGCAGAGCGAGAATATTCTTTACTCAGATAGCCAGAGTGCCATACAGTTGGTGAAAAATCCAGTCTATCATT
CGAAGACAAAGCACATCAGAAGGCGATACCATTTAACTCGCAGGGCAGTGGAGGATGGTGATATGTGCTTGGAGAAGATAGAGGGTGCAAAGAACCCGAC
AGACATGTTGACGAAATGTGTTGATGTTGGGAAACTGAGGTTATGTAAAACCTCGGTTGGTCTTTTGTAGTTGTTGCTACAGATGTATTTTTTTTGAGAA
TGTATTTTTTGGATGACTGAATTAGTCTCCAAGTGGGAGAATTGTTAGGTAGTGGAGCCTGATTAATTTTAGGTTTTCCTATTTATTCTCTATTTTAGGT
TTTCCTATTTATTCTCTATTTTAGGTTTTCCTATTTATTCTCTGTAACCAAAAATACTTTGATTTAATTAATATAAATATACCTTACCACCGTGGAAGTT
TACTCACGGGGTGTTACCACGAAATATTGGGTTTTCTCTTTCCCTCTTCTGATCTCTCATCTCTTTCTCTTGAAACTTCTTGCGTTCTTCCTTCCTCTTA
TGTGTGTGCGTCAATTCGATCCTCAACTCTCACCCATCAATTATGGCTCCAAGTGGTATTTTCTTTCCGCTTACGGGCGTCCCATTACGTTCTTAATTAC
CATTTCAGATCACTACTTCTCTTCCTCTATTCTTATCGAGAAGTATCAACTGTCCCCTTCCCCTGTTGCGTCCCTC
>LE_HBa0037A05_SP6_80264 (trimmed for quality and cloning vector)
AGGAATTGGGCAAGAAGCAGAGCGAGAATATTCTTTACTCAGATAGCCAGAGTGCCATACAGTTGGTGAAAAATCCAGTCTATCATTCGAAGACAAAGCA
CATCAGAAGGCGATACCATTTAACTCGCAGGGCAGTGGAGGATGGTGATATGTGCTTGGAGAAGATAGAGGGTGCAAAGAACCCGACAGACATGTTGACG
AAATGTGTTGATGTTGGGAAACTGAGGTTATGTAAAACCTCGGTTGGTCTTTTGTAGTTGTTGCTACAGATGTATTTTTTTTGAGAATGTATTTTTTGGA
TGACTGAATTAGTCTCCAAGTGGGAGAATTGTTAGGTAGTGGAGCCTGATTAATTTTAGGTTTTCCTATTTATTCTCTATTTTAGGTTTTCCTATTTATT
CTCTATTTTAGGTTTTCCTATTTATTCTCTGTAACCAAAAATACTTTGATTTAATTAATATAAATATACCTTACCACCGTGGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949351
Expected error %
0.154777
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||E60767 Score 84 E Value 1e-15 Identity 17.50% Align. Length 245bp (50.62%) Frame 1
retrovirus-related reverse transcriptase homolog - Arabidopsis thaliana retrotransposon copia-like (fragment)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA32025.1| Score 84 E Value 1e-15 Identity 17.50% Align. Length 245bp (50.62%) Frame 1
unnamed protein product [Nicotiana tabacum] sp|P10978|POLX_TOBAC Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Contains: Protease ; Reverse transcriptase ; Endonuclease]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0037A05
Clone
Clone name
hba-37a5
LE_HBa0037A05
P037A05
Clone type
BAC
Contamination
none
Estimated length
133,734
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found